Free counter and web stats




Vertical arrangement of leaves (371)


The ScAACT1 gene at the Qalt5 locus is as a candidate for increased aluminum tolerance (495)

Aadh >>> Adh

Aromatic alcohol dehydrogenase

Aat syn Got

Aspartat aminotransferase

AawR173-3 Petkus rye59   

Rye-specific PCR DNA primers

AawR173-3 King II

Rye-specific PCR DNA primers


Color of anthers


Acetyl-CoA carboxylase (423)


Acyl carrier protein

Acl1.2 syn Xwayc4


Acl1.3 syn Xwayc2





Acid phosphatase

Acph >>> Acp


Adgp2 syn Xwye838


Adgp3 syn Xwye1858



Albinism of seedling


Alcohol dehydrogenase

Adh syn Xcsd19



Adenylate kinase isomerase


Length of anthers (358)

al syn el

Absent ligule


Malate transporter gene likely responsible for aluminum tolerance (365,428,429)


Alkine phosphatase

alpha-Amy3 syn Xpsr14



Tolerance to excess of aluminum (410)


Tolerance to excess of aluminum, major locus (348,410,428); secretion of organic acids malate and citrate are accociated with the presence of Alt2 (417)


Tolerance to excess of aluminum  (410,428)


Tolerance to excess of aluminum (409,410,428,448); encodes an aluminum-activated organic acid transporter gene that could be utilized to increase Al tolerance in Al sensitive plant species

Amp syn Lap



amylase 30  (386)

an1 syn vi1



Anthocyaninless leaf base


Anthocyanin (green seeds)


Anthocyanin (green seeds)


Anthocyanin (green seeds)


Anthocyanin (purple seeds)

An5 syn R, R1

Anthocyanin (purple leaf base)


Anthocyanin (purple leaf base)


Anthocyanidin synthaseof anthocyanin biosynthesis pathway (476)


Antinutritive component

Apr >>> Xapr



Root  secretion of acid phosphatase (413)


Asynaptic chromosome pairing (343)

Asi >>> I(as) >>> Si



Mitochondrial genes (321)



AW15 >>> Xaw15

cDNA clone


Arabinoxylan content (381)

B... >>> Xb...

Primers (410)

BIII >>> I(a-BIII)


BCD... >>> Xbcd...

Primers (410)

Be syn firm

Brittle ear


Brown glumes




Bent lowest internode


Brittle stem (101,335)

bs syn br

Branched stem (32)

br >>> bs



Tolerance to excess of boron


Tolerance to barley yellow dwarf virus



Cat syn Xpsr484



Brown stem


Resistance to karnal bunt (Neovossia indica)


Copper efficiency




Chalcone-flavanone isomerase of anthocyanin biosynthesis pathway (476)


Chlorophyll deficiency


Shorter coleoptile length (426); coleoptile length seems to be partially dominant to long coleoptile; no correlation between seed weight and coleoptile length exists

cl >>> lu


Clr1 >>> Ner

Hybrid chlorosis in wheat-rye hybrids (444)


Chlorofom-methanol proteins

Cm16 syn Xmtd862


Cnr  syn Cre

Resistance to cereal cyst nematode (Heterodera avenae)




A mitochondrial gene responsible for an abnormal transcript causing male-sterile cytoplasm in rye (Pampa type) (339)

Cxp1 syn Xwia483


Cre >>> Cnr


CreR >>> Cnr and Cre



Shortened stamens and coalesced (374)


Short straw mutants


Short straw mutant (compact spike)


Compactum growth habit


Terminal DNA sequence


Tolerance to excess of copper



Cxp3 syn Xpsr8


Ddw55... syn Dw55...

Dominant dwarfness 55


Downward directed spikes (377)

De syn N

Dark ear


Dietary fibers content (381)



Dn7 syn Dnr syn Gbr

Resistance to the Russian wheat aphid (310)

Dnr  syn Gbr

Resistance to (green bug) aphid, dominant (Diuraphis noxia) (467)

dr syn sr

Secondary root system defective


Resistance to drought


Recessive dwarfness (382)


Desynaptic chromosome pairing (343)


Dwarf plant

dw855 syn Dw21,55

Dwarf plant, recessive

Dw155 syn Ddw155 syn Hl55



Color of spike


Early heading

el >>> al


Embp syn Xrsq805


Embp1 syn Xrsq805


Embp2 syn Xrsq805



Embryo lethality in wheat-rye hybrids, two alleles, compatible (364,440,441,442)


Embryo lethality in wheat-rye hybrids, incompatible (364,440,441,442)


Enhancer of androgenous embryoids wheat-rye  substitutions in vitro (384)


Enhancer of  albino induction in anther culture


Enhancer of genome instability of wheat (383)


Enhancer of anther culture ability and haploid induction


Enhancer of callus growth in vitro


Enhancer of equational division of univalents


Enhancer of embryogenesis in vitro



epr >>> wa


epr1 >>> wa1



Early ripening

es >>> wg





Flag leaf area

Fbp syn Xpsr39



Flavanone 3-hydroxylase of anthocyanin biosynthesis pathway (476)

firm >>> Be



Length of flag leaf


Resistance to Fusarium ssp.


Fine stripe




Width of flag leaf


Oligomer with tetranucleotide  motif  after FISH (281); in the karyogram given as red dots


Gibberellic acid insensitivity



Gb... >>> Dnr  syn Gbr

Green bug resistance, dominant (467)

Gbr >>> Dnr >>> Gb



Primer derived from granule-bound starch synthetase (GBSSI), also known as waxy) gene (363) (455)

gd55  syn mn55

Grass dwarfness


Gene encodes a bifunctional 3,5-epimerase-4-reductase in L-fucose synthesis


Glutamate dehydrogenase

Glb3 syn Xwia807



Gliadin >>>  Secalin (458)

Gli-R1 >>> Sec1


Gli-R3 >>> Sec4


Glob syn Xrsq808





Glutenin >>>  Secalin (458)

Glu-R1 >>> Sec3


Glu syn Glu1


Glu1 >>> Glu


Glu3 syn Xpsr11 >>> Sec3


Got syn Aat

Aspartat aminotransferase


Glucose-6-phosphatase dehydrogenase

Gpi syn Pgi

Glucose phosphate isomerase


Grassy plant habit

H syn Hfr

Resistance to Hessian fly (Mayetiola destructor) (459)

H155 syn Dw155

Dominant short-straw mutant (371)

Ha syn Hp syn Hs35

Hairy leaf sheath/peduncle


Flowering date (500)


Hybrid dwarfism = grass-clump phenotype in wheat-rye crosses (497)


HemA-gene encodes glutamyl-tRNA reductase

Hfr >>> H


Hg syn V         

Hairy glume

Hl55 syn Dw155 syn Ddw155



Resistance to lethal leaf blight and ear mold disease caused by Cochliobolus carbonum, race 1 (CCR1); common in all grasses; detected in maize and barley  (421)


3-hydroxymugineic acid synthetase

Hp >>> Hs >>> Ha35


Hs >>> Ha and Hp35

Hairy leaf sheath

Hsp17.3 syn Xttu1935


Hsps  >>> I(hsps)


Ia >>> I(a)



alpha-amylase inhibitor (299)


alpha-amylase inhibitor gene containing 354 nucleotides that encode amino acids (341)

I(Amy) >>> I(a)

Amylase inhibitor

I(as) syn Si  syn Asi  syn Isa

alpha-amylase/subtilisin inhibitor  (299)


Inhibitor of androgenous embryoids wheat-rye  substitutions in vitro (384)


Suppressor effect on accumulation of HSP18 and HSP70 transcripts


Major endosperm trypsin inhibitor


Iodine binding factor


Inhibitor of insect alpha-amylase (RDAI)


Dominant inhibitor suppressing desynaptic chromosome pairing (343)


Inhibitor of novel cell wall formation in wheat (396)


Secale cereale xylanase inhibitor (411)


Internode length

Isa  syn  I(as)



Number of seeds per spike (361,499)

Kw..., kw...

Thousand-kernel weight (336,499)

Lec syn Xmsu488



Light nodes (351)


Length of second internode

Iph >>> Per >>> Prx



Anthocyanin in ligule


Leafy awn (378)

Lap >>> Amp



Color of leaf


Lactate dehydrogenase


Light-green leaf color


Light node


Number of leaves of stem


Onion-like leaves (379)

Lr136 - Lr syn Pr1

Resistance to leaf (brown) rust (Puccinia recondita, P. dispersa) 6RL (380, 399, 400)


Resistance to leaf rust (Puccinia recondita) 1R


Resistance to leaf rust (Puccinia recondita) 1R


Resistance to leaf rust (Puccinia recondita)


Resistance to leaf rust (Puccinia recondita), isolate 7 (350)


Resistance to leaf rust (Puccinia recondita), isolate 12 (350)


Resistance to leaf rust (Puccinia recondita), isolate24 (486)


Resistance to leaf rust (Puccinia recondita), isolate25 (350)


Resistance to leaf rust (Puccinia recondita), isolate 81 (350)


Resistance to leaf rust (Puccinia recondita), isolate 108 (350)

lu syn cl



Leaf waxiness




Malic enzyme


Mugineic acid synthetase


Al-induced citrate transporter gene (494,495)


Monoculm growth habit (374)


Malate dehydrogenase


Manganese efficiency

mn55 >>> gd55

Multinodosum, dwarf habit55


Dwarfness with double increased number of internodes (376)


Monstrous growth habit (446); showing additional spikelets per spike


Multiple pistils

mrs1 >>> mo1>>> mo



Male sterility (368)

msh syn Xc, Xs, Xr

mismatch repair gene homologs msh2 syn Xc11; msh3 syn Xs2; msh6 syn Xr2 (456)

mu1 >>> mo

Multiflowered spike (371,446)

N >>> De



Nitrate reductase


Color of nodes


Neocentric activity


NADH dehydrogenase


Hybrid necrosis (124,443)


Non-cellulosic glucose content


Neck length


Nucleolar organizer region


Nana prostratum, short-stem ‘inch-gitl’


Number of pollen grains per anther (502)


Onion accrected leaves




3.4 kbp repetitive segment of retrotransposon-like elements (419,420;460) localized within the centromere of rye chromosomes without FISH signal in wheat chromosomes

P(cp) >>> En(cp)

Homoeologous pairing promoter


Purple culm


Perennial growth habit

P(Edu) >>> En(edu)

Promoter of equational division of univalents

Per syn Prx


Per syn Xpsr833


Pdk1 syn Xhhu1



Partial floret sterility


6-phosphogluconate dehydrogenase

Pgi >>> Gpi





Parthenogenesis induction

Ph >>> QTL3-5RL

Plant height (499)


Tolerance to inorganic orthophosphate (Pi) starvation stress  (413)

Pl >>> QTL4-5RL

Peduncle length


Resistance to powdery mildew


Powdery mildew from rye “Prolific” (478); confers a high level of resistance to the Chinese races of Blumeria graminis


Mitochondrial gene (323)

Pr3, Pr4, Pr5

Dominant resistance to Puccinia recondita f. sp. secalis (307)

Pr3 >>> Sec4

55-kD-seed protein



Prx >>> Per


Ps syn Vs

Purple seeds


Coding for components of the reaction center of photosystem II and D2 protein


Coding for a polypeptide

pSc34 >>> Xpsc34

350-480 bp family from S. cereale

pSc74 >>> Xpsc74

610 bp family from S. cereale

pSc119.2 >>> Xpsc119.2

120 bp family from S. cereale

pSc200 >>> Xpsc200

Highly repetitive sequence from S. cereale

pScJNK1 >>> XpscJNK1

Novel highly repetitive sequence from S. cereale (402)

pScT7 >>> Xpsc77

5S rDNA form S. cereale


cDNA clone, by HindIII


25S-5.8S-18S rDNA from T. aestivum

Pur-R1 >>> Xpur-R1



Yield per plant (361)


Speltoid spike

QTL1-2RL, 5RL, 7R

Flowering time, days after sowing (292,302)


Number of spikes per plant (292,302)


Plant height of main tillers (292,302,496,499)


Peduncle length of main tillers (292,302)


Number of florets per spike of main tillers (292,302,361)


Number of grains per spike of main tillers (292,302,361)

QTL7-2R, 5RL

Spike yield of main tillers (302,361)


Thousand grain weight (302,499)


Straw yield (302)


Rfclb restorer CMS (311)


Rfc2 restorer CMS (311)

QTL12-2R, 4R

Drought tolerance (338)


Number of seeds per spikelet (in wheat)


QChc.uas-1R.1,Chc1, Chlorophyll content in leaves (346,404)


QChc.uas-3R.1, Chc2, Chlorophyll content in leaves (346,404)


QChc.uas-4R.1,Chc3, Chlorophyll content in leaves (346,404)


QChc.uas-5R.1, Chc4, Chlorophyll content in leaves (346,404)


QGar.uas-5R.1, Gar1, Sensitivity of seedlings to gibberellic acid (346,404)


QGar.uas-1R.1, Gar2, Sensitivity of seedlings to gibberellic acid (346,404)


QGar.uas-7R.1, Gar3, Sensitivity of seedlings to gibberellic acid (346,404)


QAbr.uas-1R.1, Abr1, Sensitivity of seedlings to abscisic acids (346,404)


QAbr.uas-2R.1, Abr2, Sensitivity of seedlings to abscisic acids (346,404)


QAbr.uas-5R.1, Abr3, Sensitivity of seedlings to abscisic acids (346,404)


QAmy.uas-1R.1, Amy1-1, Activity of alpha-amylase  (404,407,430)


QAmy.uas-1R.2, Amy  , Activity of alpha-amylase; marker intervals Xiag95–Xapr1.5, Xubp19–Xem1.27  (430)


QAmy.uas-1R.1, Amy , Activity of alpha-amylase; marker interval Xapr1.1–Xbcd442  (430)


QAmy.uas-1R.3, Amy , Activity of alpha-amylase; marker interval Xapr1.12–Xapr1.11 (430)


QAmy.uas-2R.1, Amy2, Activity of alpha-amylase  (404,407)


QAmy.uas-2R.2, Amy , Activity of alpha-amylase, marker intervals Xapr2.24–Xapr2.22, Xpsr900–Xem2.10  (430)


QAmy.uas-2R.3, Amy , Activity of alpha-amylase, marker interval Xapr2.12–Xpsr901  (430); coincides with preharvest sprouting locus Amy1;  marker interval Xpr181-1200–Xis2.1 (473)


QAmy.uas-3R.1, Amy3, Activity of alpha-amylase  (404,407)


QAmy.uas-3R.2, Amy , Activity of alpha-amylase, marker interval Xapr3.14–Xapr3.16  (430)


QAmy.uas-3R.1, Amy , Activity of alpha-amylase; marker interval Xubp20–Xapr3.3 (430) coincides with preharvest sprouting Phs1;  marker interval Xpr665-420–Xis09-500 (473)


QAmy.uas-3R.2, Amy4, Activity of alpha-amylase  (404,407)


QAmy.uas-4R.2, Amy , Activity of alpha-amylase, marker interval Xapr4.15–Xapr4.16  (430)


QAmy.uas-4R.1, Amy , Activity of alpha-amylase; marker interval Xapr4.25–Xapr4.26  (430)


QAmy.uas-4R.3, Amy , Activity of alpha-amylase; marker interval Xpsr167–Xpsr899  (430)


QAmy.uas-5R.1, Amy5, Activity of alpha-amylase,   (404,407)


QAmy.uas-5R.2, Amy , Activity of alpha-amylase; marker intervals Xapr5.13–Xapr5.14, Xpsr1327–Xubp3  (430)


QAmy.uas-5R.1, Amy , Activity of alpha-amylase, marker interval Xapr5.2–alpha-Amy3, Xapr5.2–alpha-Amy3 (430); coincides with preharvest sprouting Phs2;  marker interval Xpr215-480–Xis43-810 (473)


QAmy.uas-5R.2, Amy6, Activity of alpha-amylase  (404,407)


QAmy.uas-5R.3, Amy , Activity of alpha-amylase; marker interval Xapr5.24–Xapr5.2  (430); 5RL =  Xrms1115, Xscm74, Xscm77 (479)


QAmy.uas-6R.2, Amy , Activity of alpha-amylase; marker interval Xpsr106-1–Xem6.11 (430); coincides with preharvest sprouting Phs3;  marker interval Xapr6.43-–Xapr6.41 (473)


QAmy.uas-6R.1, Amy7 , Activity of alpha-amylase; marker interval Xscm46–Xapr6.7  (404,407,430)


QAmy.uas-6R.1, Amy , Activity of alpha-amylase; marker interal Est5–Xpsr454  (430)


QAmy.uas-7R.2, Amy , Activity of alpha-amylase; marker interval Xopq4a–Xapr7.25 (430)


QAmy.uas-7R.1, Amy8 Activity of alpha-amylase  (404,407)


QAmy.uas-7R.2, Amy9 Activity of alpha-amylase  (404,407)


QHt.uas-3R.1, Ht1, Plant height (404,405)


QHt.uas-5R.1, Ht2, Plant height (404,405,496)


QSl.uas-5R.1, Sl1,Spike length (404,405,499)


QTgw.uas-2R.1,Tgw1, Thousand grain weight (404,405,499)


QTgw.uas-3R.1,Tgw2, Thousand grain weight (404,405,499)


QTgw.uas-5R.1,Tgw3, Thousand grain weight (404,405,499)


QKl.uas-2R.1,Kl1, Kernel length (404,405)


QKl.uas-3R.1,Kl1, Kernel length (404,405)


QKl.uas-5R.1,Kl2, Kernel length (404,405)


QKt.uas-1R.1,Kt1, Kernel thickness  (404,405)


QKt.uas-2R.1,Kt2, Kernel thickness  (404,405)


QKt.uas-3R.1,Kt3, Kernel thickness  (404,405)


QKt.uas-4R.1,Kt4, Kernel thickness  (404,405)


QKt.uas-5R.1,Kt5, Kernel thickness  (404,405)


QHd.uas-4R.1,Hd1, Heading time (404,408)


QHd.uas-5R.1,Hd2, Heading time  (404,408,496)


QFl.uas-2R.1,Fl1, Length of flag leaf  (404)


QFl.uas-4R.1,Fl2, Length of flag leaf  (404)


QSinl.uas-3R.1,Sinl1, Length of flag leaf  (404)


QSinl.uas-5R.1,Sinl2, Length of flag leaf  (404)


QSint.uas-5R.1,Sint1, Thickness of 2nd internode (404)


QSint.uas-7R.1,Sint2, Thickness of 2nd internode (404)


QKns.uas-2R.1,Kns1, Number of kernels per spike (404,499)


QKns.uas-3R.1,Kns2, Number of kernels per spike (404,499)


QKns.uas-3R.1,Kns3, Number of kernels per spike (404,499)


QVisc.uas-3R.1,Visc1, Number of kernels per spike (404,406,499)


QVisc.uas-3R.2,Visc2, Number of kernels per spike (404,406,499)


QPhs.uas-1R.2; Preharvest sprouting; marker interval Xapr1.5–Xapr1.22, Xem1.20–Xem1.27 (430)


QPhs.uas-1R.1; Preharvest sprouting; Ot1-3,  additive gene action; marker interval Xapr1.18–Xapr1.17 (416,430)


QPhs.uas-2R.1; Preharvest sprouting; Ot1-3,  dominant gene action; marker interval Xapr2.15–Xapr2.20 (416,430,473)


QPhs.uas-2R.3; Preharvest sprouting; marker interval Xapr2.12–Xpsr901 (430); coincides with preharvest sprouting locus Amy1;  marker interval Xpr181-1200–Xis2.1 (473)


QPhs.uas-3R.2; Preharvest sprouting; marker interval Xapr3.14–Xapr3.16 (430); coincides with preharvest sprouting Phs1;  marker interval Xpr665-420–Xis09-500 (473)


QPhs.uas-4R.1; Preharvest sprouting; marker interval Xapr4.25–Xapr4.26 (430)


QPhs.uas-5R.2; Preharvest sprouting; marker interval Xapr5.13–Xapr5.14 (430)


QPhs.uas-5R.3; Preharvest sprouting, marker interval Xmtd862–Dw155 (430)


QPhs.uas-5R.1; Preharvest sprouting; Ot1-3,  dominant gene action; marker intervals alpha-Amy3–Xis5.1, Xapr5.2alpha-Amy3 (416,430); coincides with preharvest sprouting Phs2;  marker interval Xpr215-480–Xis43-810 (473)


QPhs.uas-6R.2; Preharvest sprouting; marker interval Xpsr106-1–Xscm112 (430); coincides with preharvest sprouting Phs3;  marker interval Xapr6.43-–Xapr6.41 (473)


QPhs.uas-6R.1; Preharvest sprouting; Ot1-3,  dominant gene action; marker interval Xscm78–Xapr6.7, Xpsr454–XksuD2 (416,430)


QPhs.uas-7R.2; Preharvest sprouting; marker interval Xopq4a–Xapr7.25 (430)


QPhs.uas-7R.1; Preharvest sprouting; Ot1-3,  recessive gene action; marker interval Xapr7.30–Xapr7.31 (416,430)


Rooting ability, the terminal 15% of the rye 1RS arm carries gene(s) for greater rooting ability in wheat (447)


Pentosan content, confirmed after test crossing (491)


Proein content, confirmed after test crossing (491)


Protein content, confirmed after test crossing (491)


Protein content, confirmed after test crossing (491)


Protein content, confirmed after test crossing (491)


Starch content, confirmed after test crossing (491)


Starch content, confirmed after test crossing (491)


Starch content, confirmed after test crossing (491)


Starch content, confirmed after test crossing (491)


Starch content, confirmed after test crossing (491)


Thousand kernel weight, confirmed after test crossing (491,499)


Thousand kernel weight, confirmed after test crossing (491,499)


Thousand kernel weight, confirmed after test crossing (491,499)


Thousand kernel weight, confirmed after test crossing (491)


Test weight, confirmed after test crossing (491)


Test weight, confirmed after test crossing (491)


Test weight, confirmed after test crossing (491)


Test weight, confirmed after test crossing (491)


Tissue culture response, negative, immature embryos producing embryogenic callus (493)


Tissue culture response, negative, immature embryos producing embryogenic callus (493)


Tissue culture response, positive, immature embryos forming embryogenic callus (493)


Tissue culture response, positive, immature embryos forming embryogenic callus (493)


Fusarium head blight severty in triticale (48% of variability) (496)


Number of spikelets per spike (499), marker XrPt505214, XrPt505592, XrPt506504


Number of spikelets per spike (499), marker XrPt347454, XrPt401454, XrPt411244, XrPt411244, XrPt398706


Number of kernels per spike (499), marker XrPt116809, XrPt508372, XrPt508372, XrPt509637, XrPt402158, XrPt402158


Kernel weight per spike (499), marker Xrpt402364, Xrpt347771, Xrpt401519


Kernel weight per spike (499), marker XrPt344420, XrPt507897, XrPt344420


Kernel weight per spike (499), marker XrPt116809, XrPt401412, XrPt508372, XrPt390758, XrPt402158, XrPt402158


Kernel weight per spike (499), marker XrPt400777, XrPt398472, XrPt400777, XrPt399985, XrPt399985, XrPt399985


Thousand kernel weight (499), marker XrPt399985, XrPt399985, XrPt399985

R, R1 >>> An5



Red coleoptile (476)


Reed growth habit


Reduced ear (361)


Red grain


Revolver; a transposon-like gene; consists of 2929-3041 bp with an inverted repeated sequence on each end and is dispersed through all seven chromosomes  (422)

Rf syn Rfc

Male fertility restorer

Rfc >>> Rf

Male fertility restorer of the Pampa cytoplasm


Male fertility restorer of the Guelzow cytoplasm


Male fertility restorer from Iranian primitive population (313,403)


Male fertility restorer from Argentinean landrace (313,403)


Enhanced root growth ability in wheat (447)


cDNA clone from rye “Puma” highest expressed in root tissue conferring information for cold tolerance (424)


cDNA clone from rye “Puma” highest expressed in leaf tissue conferring information for cold tolerance (424)


Rye mildew




Round grain


Mitochondrial genes (322), encoding the mitochondrial 18S  ribosomal RNA


 5'-truncated mitochondrial pseudogene co-transcribed with a downstream nad4L gene (340)


Red rachis


Gene encoding the mitochondrial 18S ribosomal RNA


Reduced seed set


Anthocyanidin-3-glucoside rhamnosyltransferase of anthocyanin biosynthesis pathway (476)


Tissue culture response, negative (492)


Tissue culture response, positive (492)


A mobile element activated during tissue culture; a foldback (FB) transposon first described in rye and also the first active plant FB transposon reported

S1 >>> a1

Vertical arrangement of leaves (371)

S syn Z

Self-incompatility (353)

S5 syn Sf5



Size of antheres (502)

Sbp syn Xpsr804



Color of spike

SCXI >>> I(scx)



Soluble dietary fiber content


Secalin (458)


40-55 kDa ω-secalin showing 15 copies of the gene (354,458)

Sec1a >>> Sec1


Sec1b >>> Sec1



40-75 kDa gamma-secalin (458)



Sec3a >>> Sec3


Sec3b >>> Sec3


Sec4 syn Gli-R3 syn Pr



40-75 kDa gamma-secalin (458)



Si >>> Asi >>> I(as)



Shikimate dehydrogenase


Plants without spikes and spikelets (372,373)


Length of spike (361,499)

sl syn sp

Spreading leaf


Number of spikelets per spike (361,499)


Superoxide dismutase

sp >>> sl


Sp syn Sp1 syn Vrn

Spring growth habit (361,362,438)

Spf  >>> QTL13-1RS13 

Spikelet fertility (207,361)


Resistance to stem rust (Puccinia graminis) (380)


Resistance to stem rust (Puccinia graminis f. sp. tritici) in 1AL.1RS translocated wheat ‘Amigo’ = ‘Insave’ rye (389)

sr >>> dr


ss1 syn Xpsr490


Ss2 syn Xpsr489



Soluble starch synthetase I transporter gene (SSI) (363)


Salt-soluble protein (299)


Homoeologous pairing suppressor


Suppressor of heat shock proteins of wheat


Sucrose transporter gene wheat, homoeologous group 4


Stem waxiness

sy >>> syn


sy1 = syn1 = asc115

(182,343,359); affects recombination events

sy2 = dsc115


sy3 = asc415

Weak asynaptic mutant (345)

sy2a = dsc215


sy2b = dsc315



Causing nonhomologous synapsis (345)


Causing nonhomologous synapsis (345)


Causing nonhomologous synapsis (345)

sy9 = asc215

connected with defects of the assembly of synaptonemal complex axial cores (474)

sy10 = asc315,32

Causing nonhomologous synapsis (345,359); coupled with the presence of protein Zyp1 in the core region. The assembly of proteins Asy1 and Zyp1 on the axes of meiotic chromosomes was shown to occur separately, which is a specific feature of rye, as compared to arabidopsis (474)


Impairs the homology of meiotic chromosome synapsis (488)

syn >>> asc or dsc



Self-incompatility (353)


Aluminum-activated malate transporter renamed by the authors from TaALMT1; identical or closely linked with the Alt4 locus (409,429)

TAM... >>> Xtam...



Evolutionary translocation break point 5RL/4RL in rye (476)


Evolutionary translocation break point 6RL/3RL in rye (476)


Color of tillers




Positive tissue culture response (492)


Disturbed tetrade formation


Tulip growth habit








Triosephosphate isomerase


Coding for tRNASer (GCU)


Translocation breakpoint


Thousand grain weight (363, 425)


Thousand grain weight (363, 425) on chromosome 5R


Thousand grain weight (363, 425) on chromosome 7R




transversal yellow strips on leaf (484); lethal chlorophyll mutant

Uba syn Xpsr860



Production of unreduced gamtes in diploid rye (394); named by the author

V >>> Hg




vb >>> vi


Vdac1 syn Xtav1961


Vdac2 syn Xtav1960


vi syn an

Viridis, virescent, anthocyaninless

vi1 >>> an1


Vrn >>> Sp


Vs >>> Ps

Violet seeds

w >>> wa 1

Waxless plant with waxy nodes

wa syn epr



Waxless plant

wg syn es

Waxless glume

WG... >>> Xwg...





White glume


Resistance to wheat streak mosaic virus


Water-soluble proteins (412)

wx >>> wa164

Waxy endosperm (455,501)


STS marker




cDNA clones of barley (439)




















RFLP, DNA clone p3NTR, function: 3’untranslated region of  Adh1A, copy number:1


pSh2.25; ADP glucose pyrophosphorylase


RFLP, cDNA clone of wheat gene alpha-Amy1 (AMY-46)


RFLP, cDNA clone of wheat gene alpha-Amy2 (AMY 4848)


RFLP, cDNA clone of wheat gene alpha-Amy3 (AMY 33)


Arbitrary primer for rye genome mapping, RAPD (299,355)


RAPD marker, primer GACTACGGGG, 1600 bp fragment (412)


RAPD marker, primer CCGAATTCCC, 1400 bp fragment (412)


RAPD marker, primer ACGCCCAGAC, 520 bp fragment (412)


RAPD marker, primer TGGATCCGC, 550 bp fragment (412)


RAPD marker, primer GCACGTAGAT, 950 bp fragment (412)


RAPD marker, primer ACTCACTACA, 850 bp fragment (412)


RAPD marker, primer ACTCACTACA, 1030 bp fragment (412)


RAPD marker, primer CAGCCTACCT, 500 bp fragment (355,412)


RAPD marker, primer GTAGCCGTCT, 370 bp fragment (355,412)


RAPD marker, primer GTAGCCGTCT, 750 bp fragment (355), ACTCACTACA, 750 bp fragment (,412)


RAPD marker, primer CTGCTGGGAC, 590 bp fragment (412)


RAPD marker, primer AACGAATGCC, 870 bp fragment (412)


RAPD marker, primer CGGCTGACTT, 900 bp fragment (412)


RAPD marker, primer CACAGCGATA, 700 bp fragment (412)


RAPD marker, primer GTGTACGGAT, 1100 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 590 bp fragment (412)


RAPD marker, primer TCTCTGCGCT, 850 bp fragment (412)


RAPD marker, primer TGCCCGTCGT, 900 bp fragment (412)


RAPD marker, primer TCACAGACGC, 740 bp fragment (412)


RAPD marker, primer TCGCCAGAGT, 1000 bp fragment (412)


RAPD marker, primer TGCTCGGTTC, 1100 bp fragment (412)


RAPD marker, primer TGTCCAGCTT, 1200 bp fragment (412)


RAPD marker, primer TCGCCCCATT, 900 bp fragment (412)


RAPD marker, primer AGTTCGTCTG, 1000 bp fragment (412)


RAPD marker, primer GTCCACACGG, 400 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 750 bp fragment (412)


RAPD marker, primer TGCGGCTGAG, 650 bp fragment (412)


RAPD marker, primer GCAACTACGT, 1200 bp fragment (412)


RAPD marker, primer CTCGAGGTAA, 1030 bp fragment (412)


RAPD marker, primer GAGGATCCCT, 570 bp fragment (412)


RAPD marker, primer TCCGACAAGA, 450 bp fragment (412)


RAPD marker, primer CACCATCCAA, 840 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 1100 bp fragment (412)


RAPD marker, primer TGCCCTGCGT, 1200 bp fragment (412)


RAPD marker, primer TCGCCAGAGT, 1550 bp fragment (412)


RAPD marker, primer ACGCGCATGT, 950 bp fragment (412)


RAPD marker, primer TAGCGGCTAG, 480 bp fragment (412)


RAPD marker, primer TCTCTGCGCT, 400 bp fragment (412)


RAPD marker, primer CCGAGTCAAA, 490 bp fragment (412)


RAPD marker, primer GTGTAAGCCG, 1000 bp fragment (412


RAPD marker, primer GCACGTAGAT, 490 bp fragment (412)


RAPD marker, primer GAACTCCGCT, 900 bp fragment (412)


RAPD marker, primer TCGCCAGAGT,490 bp fragment (412)


RAPD marker, primer CGCGCACAAT, 960 bp fragment (412)


RAPD marker, primer GGTCGGAGAA, 650 bp fragment (412)


RAPD marker, primer CCCTACCGAC, 550 bp fragment (412)


RAPD marker, primer AACGCGTTCT, 2000 bp fragment (412)


RAPD marker, primer CGTACGGATA, 2000 bp fragment (412)


RAPD marker, primer ACGGTACCAG, 850 bp fragment (412)


RAPD marker, primer CGTCGGAGAA, 539 bp fragment (412)


RAPD marker, primer ATGGATCCGC, 870 bp fragment (412)


RAPD marker, primer CAAACGTCGC, 700 bp fragment (412)


RAPD marker, primer CACAGCTGCG, 750 bp fragment (355,412)


RAPD marker, primer CACAGCGAAA, 450 bp fragment (355,412)


RAPD marker, primer ACCTCAGCCT, 450 bp fragment (355,412)


RAPD marker, primer GGGAACTGAT, 800 bp fragment (412)


RAPD marker, primer CATCCCCCTG, 1200 bp fragment (412)


RAPD marker, primer CATCCCCCTG, 1150 bp fragment (412)


RAPD marker, primer TTGCGGAGAA, 520 bp fragment (412)


RAPD marker, primer GTTTCGCTGG, 460 bp fragment (412)


RAPD marker, primer AGGAGACTGG, 830 bp fragment (412)


RAPD marker, primer CCGTCGCCTA, 670 bp fragment (412)


RAPD marker, primer AAGCACCGGC, 450 bp fragment (412)


RAPD marker, primer CAGACGGTGT, 880 bp fragment (412)


RAPD marker, primer CCTTGACGCA, 430 bp fragment (412)


RAPD marker, primer CACAGCGAAT, 800 bp fragment (412)


RAPD marker, primer CGTCTGGGAA, 900 bp fragment (412)


RAPD marker, primer CCTTGCAACT, 850 bp fragment (412)


RAPD marker, primer TCAGCCCCTG, 800 bp fragment (412)


RAPD marker, primer GCACGTAGAT, 500 bp fragment (412)


RAPD marker, primer AACGGTGACC, 750 bp fragment (412)


RAPD marker, primer AACGGTGACC, 1600 bp fragment (412)


RAPD marker, primer CCGAATTCCC, 1100 bp fragment (412)


RAPD marker, primer GTGATCGCAG, 530 bp fragment (412)


RAPD marker, primer GGTCTAGAGG, 910 bp fragment (412)


RAPD marker, primer GGTCTAGAGG, 800 bp fragment (412)


RAPD marker, primer ATGACGTTGA, 830 bp fragment (412)


RAPD marker, primer GGACTGGAGT, 900 bp fragment (412)


RAPD marker, primer CACAGCGAAA, 700 bp fragment (355)


RAPD marker, primer CCGAGTCAAA, 650 bp fragment (412)


RAPD marker, primer CGATAGCGGA, 700 bp fragment (412)


RAPD marker, primer TGGCGTCCAG, 450 bp fragment (412)


RAPD marker, primer AACGGTGACC, 820 bp fragment (412)


RAPD marker, primer CACTCTCCTC, 700 bp fragment (412)


RAPD marker, primer GGGTTGCCGA, 800 bp fragment (412)


RAPD marker, primer GGATGCATGT, 1800 bp fragment (412)


RAPD marker, primer ACGCGCATGT, 1200 bp fragment (412)


RAPD marker, primer CTCGGCTGAA, 400 bp fragment (412)


RAPD marker, primer CATGTAGACC, 800 bp fragment (412)


RAPD marker, primer GTGTACGGAT,1800 bp fragment (412)


RAPD marker, primer GTGACGTAGG, 710 bp fragment (412)


RAPD marker, primer AGATGCAGCC, 750 bp fragment (412)


RAPD marker, primer GGGTCCCTTG, 840 bp fragment (412)


RAPD marker, primer AACGCGTTCT, 1700 bp fragment (412)


RAPD marker, primer AGTATCGACC, 750 bp fragment (412)


RAPD marker, primer CCACTGTTAG, 350 bp fragment (412)


RAPD marker, primer AGAGATCTCC, 430 bp fragment (412)


RAPD marker, primer CTTCACCCGA, 350 bp fragment (412)


RAPD marker, primer CTTCACCCGA, 540 bp fragment (412)


RAPD marker, primer AACGCGTTCT, 460 bp fragment (412)


RAPD marker, primer GACTACGGGG, 500 bp fragment (412)


RAPD marker, primer TCTCAGCTGG, 650 bp fragment (412)


RAPD marker, primer GGGCCACGCT, 840 bp fragment (412)


RAPD marker, primer AGAATCGGGG, 520 bp fragment (412)


RAPD marker, primer ACGTAGCGAT, 900 bp fragment (355)


RAPD marker, primer CAGCCTACCG, 950 bp fragment (355)


RAPD marker, primer CGGTCCAGGC, 420 bp fragment (412)


RAPD marker, primer GACTCCCGTT, 850 bp fragment (412)


RAPD marker, primer AGCGCGTAAG, 1900 bp fragment (412)


RAPD marker, primer CCTCTGCCCC, 770 bp fragment (412)


RAPD marker, primer GATTTCTGCT, 700 bp fragment (412)


RAPD marker, primer CACAGCCAGT, 700 bp fragment (412)


RAPD marker, primer CGTCGCGTCA, 1400 bp fragment (412)


RAPD marker, primer CACAGCGACT, 940 bp fragment (412)


RAPD marker, primer CGAATCGCGC, 850 bp fragment (412)


RAPD marker, primer GGTCGGAGAT, 1300 bp fragment (412)


RAPD marker, primer ACGGTACCAG, 540 bp fragment (412)


RAPD marker, primer GGTCCCTGAC, 510 bp fragment (412)


RAPD marker, primer GGTCCCTGAC, 1200 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 750 bp fragment (412)


RAPD marker, primer TCCGCGGTCT, 750 bp fragment (412)


RAPD marker, primer AGGGTGTACG, 350 bp fragment (412)


RAPD marker, primer GTGATCGCAG, 1200 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)


RAPD marker, primer AGATGCAGCC, 580 bp fragment (412)


RAPD marker, primer CGTCTAGAGG,  510 bp fragment (412)


RAPD marker, primer ACGATGAGCT, 590 bp fragment (412)


RAPD marker, primer GTGATCGCTG, 460 bp fragment (412)


RAPD marker, primer ACCTCAGCCA, 500 bp fragment (355)


RAPD marker, primer CGTCGCGTCA, 1200 bp fragment (355)


RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)


RAPD marker, primer CGGGATGTTA, 440 bp fragment (412)


RAPD marker, primer CCACACACAA, 440 bp fragment (412)


RAPD marker, primer ATGACGTTGA, 640 bp fragment (412)


RAPD marker, primer CCAGGGTGTT, 840 bp fragment (412)


RAPD marker, primer ACTGGATCGT, 210 bp fragment (412)


RAPD marker, primer ACTGGATCGT, 600 bp fragment (412)


RAPD marker, primer GAACGACGCA, 670 bp fragment (412)


RAPD marker, primer GTGTAAGCCG, 620 bp fragment (412)


RAPD marker, primer CCTTGACGCA, 1400 bp fragment (412)


RAPD marker, primer CTGTAGCCGG, 490 bp fragment (412)


RAPD marker, primer GAACTCCGCT, 410 bp fragment (412)


RAPD marker, primer CAGCACCCAT, 630 bp fragment (412)


RAPD marker, primer CTCGAGGTAA, 390 bp fragment (449)


RAPD marker, primer ACCTCAGCGT, 550 bp fragment (449)


RAPD marker, primer GTAGCCGTCT, 700 bp fragment (449)


RAPD marker, primer AGGAGACTGG, 260 bp fragment (449)


RAPD marker, primer CCGTTCCAAA, 900 bp fragment (449)


RAPD marker, primer AACCCACCCG, 650 bp fragment (449)


RAPD marker, primer GCGCGATAAG, 600 bp fragment (449)


RAPD marker, primer CGTGATAAGG, 670 bp fragment (449)


RAPD marker, primer CCCAAGTCAT, 1300 bp fragment (449)


RAPD marker, primer ATGTGTGTGG, 530 bp fragment (449)


RAPD marker, primer GGAGTGTGTA, 1000 bp fragment (449)


RAPD marker, primer GGAGTGTGTA, 750 bp fragment (449)


RAPD marker, primer CTGTAGCCGG, 750 bp fragment (449)


RAPD marker, primer ACCCCCCACG, 620 bp fragment (449)


RAPD marker, primer CTGAGACGGA, 480 bp fragment (449)


RAPD marker, primer ACCTCCAGCG, 1030 bp fragment (449)


RAPD marker, primer CCGCCTAGTC, 900 bp fragment (449)


RAPD marker, primer CCTCTGCCCA, 650 bp fragment (449)


RAPD marker, primer CGCCCCCAGC, 430 bp fragment (449)


RAPD marker, primer CAAGCGGATC, 950 bp fragment (449)


RAPD marker, primer CAGCCTACAG, 600 bp fragment (449)


RAPD marker, primer GTCCGTTGGG, 650 bp fragment (449)


RAPD marker, primer GACAAAGAGG, 550 bp fragment (449)


RAPD marker, primer AAGCCTCGTC, 1700 bp fragment (449)


RAPD marker, primer CAGTCGCGTG, 1400 bp fragment (449)


RAPD marker, primer TGTCCAGCTT, 710 bp fragment (449)


RAPD marker, primer GCCATAAGCG, 920 bp fragment (449)


RAPD marker, primer ACGAAGCTAA, 500 bp fragment (449)


RAPD marker, primer CCACGCTATA, 600 bp fragment (449)


RAPD marker, primer ACATGTTCGG, 1700 bp fragment (449)


RAPD marker, primer CCTCTCGCAA, 410 bp fragment (449)


RAPD marker, primer CGGCCCACGT, 690 bp fragment (449)


RAPD marker, primer TGCAGTTAGT, 730 bp fragment (449)


RAPD marker, primer GGGTAACGCA, 1100 bp fragment (449)


RAPD marker, primer TGTCCAGCTT, 400 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 350 bp fragment (412)


RAPD marker, primer TGCCGCTAAG, 900 bp fragment (412)


RAPD marker, primer TCGCGCTGTC, 700 bp fragment (412)


RAPD marker, primer GTGTACGGAT, 800 bp fragment (412)


RAPD marker, primer GTGATCGCAG, 330 bp fragment (412)


RAPD marker, primer TGCCCGTCGT, 750 bp fragment (412)


RAPD marker, primer GGATGAGACC, 660 bp fragment (412)


RAPD marker, primer TCCCGAACCG, 830 bp fragment (412)


RAPD marker, primer GGGCCACGCT, 1400 bp fragment (412)


RAPD marker, primer ACGCCCAGGG, 1350 bp fragment (412)


RAPD marker, primer ACGCCCAGGG, 650 bp fragment (412)


RAPD marker, primer CCTCTGCCCA, 1100 bp fragment (412)


RAPD marker, primer TCAGAGCGCC, 900 bp fragment (355,412)


RAPD marker, primer CAGCCTACCT, 850 bp fragment (355,412)


RAPD marker, primer CACAGCGAAT, 1500 bp fragment (355,412)


RAPD marker, primer CCAGGGTGAC, 1300 bp fragment (355,412)


RAPD marker, primer TTAGCCGATC, 960 bp fragment (355,412)


RAPD marker, primer CCTCTCGCAA, 550 bp fragment (355,412)


RAPD marker, primer CAGTCTCGTC, 1500 bp fragment (355,412)


RAPD marker, primer CGTCGCGTCA, 1200 bp fragment (355,412)


RAPD marker, primer GGGCTGACTT, 350 bp fragment (412)


RAPD marker, primer CAGCACCCAT, 660 bp fragment (412)


RAPD marker, primer CACAGCGAAT, 490 bp fragment (412)


RAPD marker, primer CGCATTACGC, 1050 bp fragment (412)


RAPD marker, primer GGTCGGAGAT, 980 bp fragment (412)


RAPD marker, primer CCACACACTA, 500 bp fragment (412)


RAPD marker, primer TAGACGTCGC, 1350 bp fragment (412)


RAPD marker, primer AGCCTGTGTG, 550 bp fragment (412)


RAPD marker, primer TTGGGCTGAC, 350 bp fragment (412)


RAPD marker, primer CCTCTGCCCA, 1100 bp fragment (412)


RAPD marker, primer ACGCCCAGGG, 500 bp fragment (412)


RAPD marker, primer CTCCGTTGGG, 1350 bp fragment (412)


RAPD marker, primer GACACGTCTG, 780 bp fragment (412)


RAPD marker, primer CCTCTGCCCA, 780 bp fragment (412)


RAPD marker, primer CCCTACCGAC, 1500 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 1700 bp fragment (412)


RAPD marker, primer GGTCGGAGAA, 1000 bp fragment (412)


RFLP, cDNA clone pc betac51 of barley


RFLP markers (328,410)


Primer sequence GGT GCA TTT CTG GTG GC (410)




Probe for labelling two chromosomes 1R and ?? (482)




RFLP,cDNA clones of barley and rye (410,439)


RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by DraI


RFLP, cDNA clone, by XbaI


RFLP, cDNA clone, by DraI




RFLP, cDNA clone, by EcoRI


RFLP, cDNA clone, by EcoRI


RFLP, cDNA clone, by EcoRV






Primer sequence GCGACTCACGAAAGATTGGT (410)


RFLP, cDNA clone, by EcoRV


SSR marker of barley origin (331,471)


RFLP, pCat2.1c


RFLP, cDNA clones of oat (439)




RFLP, cDNA clone, by EcoRI


RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by DraI




RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by EcoRV


cRFLP, DNA clone, by DraI




























RFLP, Clone pLamdac.3, function: carboxy-peptidase-1


RFL, DNA clones

Xcslrgh3 ...

RFLP,  marker (330)


DArT markers (Diversity Arrays Technology, microarray-based method allowing for detection of DNA polymorphism at several thousand loci in a single assay without relying on DNA sequence information) (457)


RFLP, DNA clone p1015, function: early-methionine-labelled polypeptide, copy number:3


AFLP marker, primer EAAAMCGG, 220 bp fragment (355,412)


AFLP marker, primer EAAAMCGG, 48 bp fragment (355,412)


AFLP marker, primer EAACMCTG, 92 bp fragment (355)


AFLP marker, primer EAACMCTG, 113 bp fragment (355,412)


AFLP marker, primer EAACMCTG, 142 bp fragment (355,412)


AFLP marker, primer EAAGMCCG, 178 bp fragment (355,412)


AFLP marker, primer EAAGMCCG, 199 bp fragment (355,412)


AFLP marker, primer EAAGMCCG, 218 bp fragment (355,412)


AFLP marker, primer EAATMCGA, 187 bp fragment (355,412)


AFLP marker, primer EAATMCGA, 229 bp fragment (355,412)


AFLP marker, primer EAATMCGT, 140 bp fragment (355,412)


AFLP marker, primer EAATMCGT, 172 bp fragment (355,412)


AFLP marker, primer EAATMCTG, 170 bp fragment (355,412)


AFLP marker, primer EACAMCGG, 143 bp fragment (355,412)


AFLP marker, primer EACAMCGG, 306 bp fragment (355,412)


AFLP marker, primer EACAMCTG, 198 bp fragment (355,412)


AFLP marker, primer EACCMCGC, 156 bp fragment (355,412)


AFLP marker, primer EACCMCGG, 128 bp fragment (355,412)


AFLP marker, primer EACCMCGG, 134 bp fragment (355,412)


AFLP marker, primer EACCMCGG, 200 bp fragment (355,412)


AFLP marker, primer EACCMCTT, 121 bp fragment (355,412)


AFLP marker, primer EACCMCTT, 177 bp fragment (355,412)


AFLP marker, primer EAGCMCAA, 123 bp fragment (355,412)


AFLP marker, primer EAGCMCAA, 233 bp fragment (355,412)


AFLP marker, primer EAGGMCCG, 159 bp fragment (355,412)


AFLP marker, primer EAGTMCAA, 205 bp fragment (355,412)


AFLP marker, primer EAGTMCCT, 189 bp fragment (355,412)


AFLP marker, primer EAGTMCTT, 131 bp fragment (355,412)


AFLP marker, primer EATGMCGG, 141 bp fragment (355,412)


AFLP marker, primer EATGMCGG, 160 bp fragment (355)


AFLP marker, primer EATGMCGG, 181 bp fragment (355,412)


AFLP marker, primer EATTMCTT, 201 bp fragment (355,412)


AFLP marker, primer EAGGMCAG, 152 bp fragment (355)


AFLP marker, primer EAGGMCAG, 243 bp fragment (355)


AFLP marker, primer EAGGMCAG, 286 bp fragment (355)


AFLP marker, primer EAGGMCAG, 308 bp fragment (355,412)


AFLP marker, primer EAAAMCGG, 101 bp fragment (355)


AFLP marker, primer EAAAMCGG, 107 bp fragment (355)


AFLP marker, primer EAACMCCC, 266 bp fragment (355)


AFLP marker, primer EAAGMCCT, 157 bp fragment (355)


AFLP marker, primer EAATMCTG, 167 bp fragment (355)


AFLP marker, primer EACAMCGG, 215 bp fragment (355)


AFLP marker, primer EACAMCTG, 99 bp fragment (355)


AFLP marker, primer EACCMCGC, 129 bp fragment (355)


AFLP marker, primer EACCMCGC, 196 bp fragment (355)


AFLP marker, primer EACTMCCG, 294 bp fragment (355)


AFLP marker, primer EAGCMCAA, 239 bp fragment (355)


AFLP marker, primer EAGCMCGC, 282 bp fragment (355)


AFLP marker, primer EAGGMCCG, 194 bp fragment (355)


AFLP marker, primer EAGGMCCG, 222 bp fragment (355)


AFLP marker, primer EAGGMCTG, 108 bp fragment (355)


AFLP marker, primer EAGTMCGG, 169 bp fragment (355)


AFLP marker, primer EAGTMCTT, 215 bp fragment (355)


AFLP marker, primer EATGMCGG, 144 bp fragment (355)


AFLP marker, primer EATTMCTT, 152 bp fragment (355)


AFLP marker, primer EACCMCTG, 220 bp fragment (355)


AFLP marker, primer EACCMCTG, 205 bp fragment (355)


AFLP marker, primer EACCMCTG, 209 bp fragment (355)


AFLP marker, primer EACGMCAG, 131 bp fragment (355)


AFLP marker, primer EAGGMCAG, 159 bp fragment (355)


AFLP marker, primer EAGGMCAG, 166 bp fragment (355)


AFLP marker, primer EAGGMCAG, 232 bp fragment (355)


AFLP marker, primer EAGGMCAG, 265 bp fragment (355)


AFLP marker, primer EAGGMCAG, 290 bp fragment (355)


AFLP marker, primer EAAAMCAT, 114 bp fragment (355)


AFLP marker, primer EAAGMCCG, 219 bp fragment (355)


AFLP marker, primer EAATMCTG, 147 bp fragment (355)


AFLP marker, primer EAATMCTG, 164 bp fragment (355)


AFLP marker, primer EAATMCGA, 285 bp fragment (355)


AFLP marker, primer EAATMCTG, 204 bp fragment (355)


AFLP marker, primer EACAMCGG, 152 bp fragment (355)


AFLP marker, primer EACAMCTG, 178 bp fragment (355)


AFLP marker, primer EACCMCGC, 209 bp fragment (355)


AFLP marker, primer EACCMCGG, 90 bp fragment (355)


AFLP marker, primer EACCMCTT, 101 bp fragment (355)


AFLP marker, primer EACGMCCG, 114 bp fragment (355)


AFLP marker, primer EACTMCCG, 159 bp fragment (355)


AFLP marker, primer EAGGMCCG, 135 bp fragment (355)


AFLP marker, primer EAGGMCCG, 175 bp fragment (355)


AFLP marker, primer EAGGMCGG, 131 bp fragment (355)


AFLP marker, primer EAGGMCTG, 93 bp fragment (355)


AFLP marker, primer EAGGMCTG, 169 bp fragment (355)


AFLP marker, primer EAGTMCAA, 171 bp fragment (355)


AFLP marker, primer EAGTMCCT, 179 bp fragment (355)


AFLP marker, primer EAGTMCGC, 110 bp fragment (355)


AFLP marker, primer EATGMCGG, 239 bp fragment (355)


AFLP marker, primer EATTMCTT, 121 bp fragment (355)


AFLP marker, primer EATTMCTT, 173 bp fragment (355)


AFLP marker, primer EATTMCTT, 181 bp fragment (355)


AFLP marker, primer EACCMCTG, 112 bp fragment (355)


AFLP marker, primer EACGMCAC, 121 bp fragment (355)


AFLP marker, primer EACGMCAC, 200 bp fragment (355)


AFLP marker, primer EAGGMCAG, 182 bp fragment (355)


AFLP marker, primer EAGGMCAG, 302 bp fragment (355)


AFLP marker, primer EAACMCCC, 178 bp fragment (355)


AFLP marker, primer EAACMCCC, 272 bp fragment (355)


AFLP marker, primer EAACMCTG, 289 bp fragment (355)


AFLP marker, primer EAAGMCCT, 156 bp fragment (355)


AFLP marker, primer EAAGMCCT, 171 bp fragment (355)


AFLP marker, primer EAATMCGA, 268 bp fragment (355)


AFLP marker, primer EAATMCGT, 212 bp fragment (355)


AFLP marker, primer EAATMCGT, 213 bp fragment (355)


AFLP marker, primer EAATMCTG, 196 bp fragment (355)


AFLP marker, primer EACAMCGG, 168 bp fragment (355)


AFLP marker, primer EACAMCTG, 180 bp fragment (355)


AFLP marker, primer EACCMCGC, 267 bp fragment (355)


AFLP marker, primer EACCMCGG, 110 bp fragment (355)


AFLP marker, primer EACCMCTT, 179 bp fragment (355)


AFLP marker, primer EACGMCCG, 131 bp fragment (355)


AFLP marker, primer EACGMCCG, 208 bp fragment (355)


AFLP marker, primer EAGCMCAA, 186 bp fragment (355)


AFLP marker, primer EAGCMCAA, 213 bp fragment (355)


AFLP marker, primer EAGGMCCG, 132 bp fragment (355)


AFLP marker, primer EAGGMCTG, 274 bp fragment (355)


AFLP marker, primer EAGTMCAA, 97 bp fragment (355)


AFLP marker, primer EAGTMCAA, 127 bp fragment (355)


AFLP marker, primer EAGTMCAA, 165 bp fragment (355)


AFLP marker, primer EAGTMCCT, 84 bp fragment (355)


AFLP marker, primer EAGTMCCT, 130 bp fragment (355)


AFLP marker, primer EAGTMCGT, 114 bp fragment (355)


AFLP marker, primer EAGTMCTC, 196 bp fragment (355)


AFLP marker, primer EATGMCGG, 138 bp fragment (355)


AFLP marker, primer EATGMCGG, 270 bp fragment (355)


AFLP marker, primer EACCMCTA, 122 bp fragment (355)


AFLP marker, primer EACGMCAG, 205 bp fragment (355)


AFLP marker, primer EAAAMCAA, 94 bp fragment (355)


AFLP marker, primer EAAAMCAA, 107 bp fragment (355)


AFLP marker, primer EAAAMCAA, 143 bp fragment (355)


AFLP marker, primer EAAAMCAT, 134 bp fragment (355)


AFLP marker, primer EAACMCCC, 184 bp fragment (355)


AFLP marker, primer EAACMCTG, 149 bp fragment (355)


AFLP marker, primer EAAGMCCT, 250 bp fragment (355)


AFLP marker, primer EAATMCGA, 220 bp fragment (355)


AFLP marker, primer EAATMCTG, 87 bp fragment (355)


AFLP marker, primer EAATMCTG, 198 bp fragment (355)


AFLP marker, primer EACCMCGC, 239 bp fragment (355)


AFLP marker, primer EACCMCGG, 172 bp fragment (355)


AFLP marker, primer EAGCMCGC, 205 bp fragment (355)


AFLP marker, primer EAGGMCCG, 141 bp fragment (355)


AFLP marker, primer EAGTMCAA, 179 bp fragment (355)


AFLP marker, primer EAGTMCGG, 283 bp fragment (355)


AFLP marker, primer EAGTMCGG, 285 bp fragment (355)


AFLP marker, primer EACCMCTA, 136 bp fragment (355)


AFLP marker, primer EACGMCAC, 119 bp fragment (355)


AFLP marker, primer EAATMCGT, 121 bp fragment (355)


AFLP marker, primer EAATMCTG, 102 bp fragment (355)


AFLP marker, primer EACAMCTG, 112 bp fragment (355)


AFLP marker, primer EACGMCCG, 203 bp fragment (355)


AFLP marker, primer EACCMCTA, 103 bp fragment (355)


AFLP marker, primer EACCMCTA, 191 bp fragment (355)


AFLP marker, primer EACGMCAG, 100 bp fragment (355)


AFLP marker, primer EACGMCAG, 108 bp fragment (355)


AFLP marker, primer EAGGMCAG, 133 bp fragment (355)


AFLP marker, primer EAGGMCAG, 238 bp fragment (355)


AFLP marker, primer EAGGMCAG, 260 bp fragment (355)


AFLP marker, primer EAGGMCAG, 315 bp fragment (355)


 AFLP marker, primer EAAAMCGG, 175 bp fragment (355)


AFLP marker, primer EAACMCCC, 224 bp fragment (355)


AFLP marker, primer EAACMCTG, 195 bp fragment (355)


AFLP marker, primer EAAGMCCG, 254 bp fragment (355)


AFLP marker, primer EAAGMCCT, 130 bp fragment (355)


AFLP marker, primer EAAGMCCT, 249 bp fragment (355)


AFLP marker, primer EAATMCGT, 208 bp fragment (355)


AFLP marker, primer EACCMCGC, 298 bp fragment (355)


 AFLP marker, primer EAGCMCAA, 108 bp fragment (355)


AFLP marker, primer EAGCMCAA, 222 bp fragment (355)


AFLP marker, primer EAGGMCCG, 158 bp fragment (355)


AFLP marker, primer EAGGMCTG, 164 bp fragment (355)


AFLP marker, primer EAGTMCCT, 94 bp fragment (355)


AFLP marker, primer EAGTMCCT, 95 bp fragment (355)


AFLP marker, primer EAGTMCGG, 147 bp fragment (355)


AFLP marker, primer EAGTMCGT, 81 bp fragment (355)


AFLP marker, primer EAGTMCGT, 94 bp fragment (355)


AFLP marker, primer EAGTMCTC, 151 bp fragment (355)


AFLP marker, primer EAGTMCTC, 191 bp fragment (355)


AFLP marker, primer EAGTMCTT, 171 bp fragment (355)


AFLP marker, primer EACCMCTA, 131 bp fragment (355)


AFLP marker, primer EAGGMCAG, 114 bp fragment (355)


AFLP marker, primer EAGGMCAG, 202 bp fragment (355)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


RFLP, cDNA clone pGC19, function: bZIP protein


RFLP, PSR39 clone; wheat chloroplast fructose-1.6-biphosphatase

Xfed  ...

Ferredoxin (terminal receptor of  electrons from photo-system I)


RFLP, Germin cDNA


RFLP, pLW2.1








RFLP, DNA clone pTag544, function: low-molecular-weight glutenin, Copy number:1


STS marker (331)
























Microsatellite on 7RS; allele size 117 bp (410)


















