Free counter and web stats
rye-banner

Gene/Marker

Descriptor

a1

Vertical arrangement of leaves (371)

Aact1

The ScAACT1 gene at the Qalt5 locus is as a candidate for increased aluminum tolerance (495)

Aadh >>> Adh

Aromatic alcohol dehydrogenase

Aat syn Got

Aspartat aminotransferase

AawR173-3 Petkus rye59   

Rye-specific PCR DNA primers

AawR173-3 King II

Rye-specific PCR DNA primers

Ac

Color of anthers

Acc240

Acetyl-CoA carboxylase (423)

Acl

Acyl carrier protein

Acl1.2 syn Xwayc4

 

Acl1.3 syn Xwayc2

 

Aco

Aconitase

Acp

Acid phosphatase

Acph >>> Acp

 

Adgp2 syn Xwye838

 

Adgp3 syn Xwye1858

 

alb

Albinism of seedling

Adh

Alcohol dehydrogenase

Adh syn Xcsd19

 

Adk

Adenylate kinase isomerase

Al

Length of anthers (358)

al syn el

Absent ligule

Almt142

Malate transporter gene likely responsible for aluminum tolerance (365,428,429)

Alp

Alkine phosphatase

alpha-Amy3 syn Xpsr14

 

Alt1-6RS

Tolerance to excess of aluminum (410)

Alt2-3RS

Tolerance to excess of aluminum, major locus (348,410,428); secretion of organic acids malate and citrate are accociated with the presence of Alt2 (417)

Alt3-4RL

Tolerance to excess of aluminum  (410,428)

Alt4-7RS53

Tolerance to excess of aluminum (409,410,428,448); encodes an aluminum-activated organic acid transporter gene that could be utilized to increase Al tolerance in Al sensitive plant species

Amp syn Lap

Aminopeptidase

Amy...

amylase 30  (386)

an1 syn vi1

Anthocyaninless

an2

Anthocyaninless leaf base

An1  

Anthocyanin (green seeds)

An1a

Anthocyanin (green seeds)

An1b

Anthocyanin (green seeds)

An3,4,6

Anthocyanin (purple seeds)

An5 syn R, R1

Anthocyanin (purple leaf base)

An7

Anthocyanin (purple leaf base)

Ans58

Anthocyanidin synthaseof anthocyanin biosynthesis pathway (476)

Anu...

Antinutritive component

Apr >>> Xapr

 

APase

Root  secretion of acid phosphatase (413)

asc...

Asynaptic chromosome pairing (343)

Asi >>> I(as) >>> Si

 

atp

Mitochondrial genes (321)

au

Aurea

AW15 >>> Xaw15

cDNA clone

Axc

Arabinoxylan content (381)

B... >>> Xb...

Primers (410)

BIII >>> I(a-BIII)

 

BCD... >>> Xbcd...

Primers (410)

Be syn firm

Brittle ear

bg

Brown glumes

beta-Glu1

beta-Glucosidase

bn

Bent lowest internode

br...

Brittle stem (101,335)

bs syn br

Branched stem (32)

br >>> bs

 

Bt

Tolerance to excess of boron

Byd 

Tolerance to barley yellow dwarf virus

Cat

Catalase

Cat syn Xpsr484

 

cb

Brown stem

Cbt

Resistance to karnal bunt (Neovossia indica)

Ce

Copper efficiency

centr

Centromere

Chi58

Chalcone-flavanone isomerase of anthocyanin biosynthesis pathway (476)

Chl

Chlorophyll deficiency

Cl

Shorter coleoptile length (426); coleoptile length seems to be partially dominant to long coleoptile; no correlation between seed weight and coleoptile length exists

cl >>> lu

 

Clr1 >>> Ner

Hybrid chlorosis in wheat-rye hybrids (444)

Cm

Chlorofom-methanol proteins

Cm16 syn Xmtd862

 

Cnr  syn Cre

Resistance to cereal cyst nematode (Heterodera avenae)

Co

Corroded

cob

A mitochondrial gene responsible for an abnormal transcript causing male-sterile cytoplasm in rye (Pampa type) (339)

Cxp1 syn Xwia483

 

Cre >>> Cnr

 

CreR >>> Cnr and Cre

 

cs

Shortened stamens and coalesced (374)

ct55...

Short straw mutants

ct255

Short straw mutant (compact spike)

ct355

Compactum growth habit

CTer

Terminal DNA sequence

Cut

Tolerance to excess of copper

Cxp

Carboxypeptidase

Cxp3 syn Xpsr8

 

Ddw55... syn Dw55...

Dominant dwarfness 55

de

Downward directed spikes (377)

De syn N

Dark ear

Dec

Dietary fibers content (381)

Dia33

Diaphorase

Dn7 syn Dnr syn Gbr

Resistance to the Russian wheat aphid (310)

Dnr  syn Gbr

Resistance to (green bug) aphid, dominant (Diuraphis noxia) (467)

dr syn sr

Secondary root system defective

drr

Resistance to drought

ds155

Recessive dwarfness (382)

dsc...

Desynaptic chromosome pairing (343)

dw55

Dwarf plant

dw855 syn Dw21,55

Dwarf plant, recessive

Dw155 syn Ddw155 syn Hl55

(371)

Ec

Color of spike

eh

Early heading

el >>> al

Eligulatum

Embp syn Xrsq805

 

Embp1 syn Xrsq805

 

Embp2 syn Xrsq805

 

Eml-1Ra48

Embryo lethality in wheat-rye hybrids, two alleles, compatible (364,440,441,442)

Eml-1Rb48

Embryo lethality in wheat-rye hybrids, incompatible (364,440,441,442)

En(ae)

Enhancer of androgenous embryoids wheat-rye  substitutions in vitro (384)

En(ai)

Enhancer of  albino induction in anther culture

En(gi)

Enhancer of genome instability of wheat (383)

En(hi)

Enhancer of anther culture ability and haploid induction

En(cg)

Enhancer of callus growth in vitro

En(edu)17

Enhancer of equational division of univalents

En(em)

Enhancer of embryogenesis in vitro

Ep...

Endopeptidase

epr >>> wa

 

epr1 >>> wa1

 

Er...

Early ripening

es >>> wg

 

Est43...

Esterase

Fa

Flag leaf area

Fbp syn Xpsr39

 

F3h58

Flavanone 3-hydroxylase of anthocyanin biosynthesis pathway (476)

firm >>> Be

 

Fl

Length of flag leaf

Fr

Resistance to Fusarium ssp.

fs

Fine stripe

fv

Flavovirescent

Fw

Width of flag leaf

(GACA)4

Oligomer with tetranucleotide  motif  after FISH (281); in the karyogram given as red dots

Gai 

Gibberellic acid insensitivity

Gal

Galactosidase

Gb... >>> Dnr  syn Gbr

Green bug resistance, dominant (467)

Gbr >>> Dnr >>> Gb

 

Gbs

Primer derived from granule-bound starch synthetase (GBSSI), also known as waxy) gene (363) (455)

gd55  syn mn55

Grass dwarfness

Ger147

Gene encodes a bifunctional 3,5-epimerase-4-reductase in L-fucose synthesis

Gdh

Glutamate dehydrogenase

Glb3 syn Xwia807

 

Gli

Gliadin >>>  Secalin (458)

Gli-R1 >>> Sec1

 

Gli-R3 >>> Sec4

 

Glob syn Xrsq808

 

GloB

Three-beta-globin

Glu...

Glutenin >>>  Secalin (458)

Glu-R1 >>> Sec3

 

Glu syn Glu1

 

Glu1 >>> Glu

 

Glu3 syn Xpsr11 >>> Sec3

 

Got syn Aat

Aspartat aminotransferase

Gpd

Glucose-6-phosphatase dehydrogenase

Gpi syn Pgi

Glucose phosphate isomerase

gr

Grassy plant habit

H syn Hfr

Resistance to Hessian fly (Mayetiola destructor) (459)

H155 syn Dw155

Dominant short-straw mutant (371)

Ha syn Hp syn Hs35

Hairy leaf sheath/peduncle

Hd163

Flowering date (500)

Hdw-R1B

Hybrid dwarfism = grass-clump phenotype in wheat-rye crosses (497)

HemA

HemA-gene encodes glutamyl-tRNA reductase

Hfr >>> H

 

Hg syn V         

Hairy glume

Hl55 syn Dw155 syn Ddw155

251

Hm138

Resistance to lethal leaf blight and ear mold disease caused by Cochliobolus carbonum, race 1 (CCR1); common in all grasses; detected in maize and barley  (421)

Hma

3-hydroxymugineic acid synthetase

Hp >>> Hs >>> Ha35

 

Hs >>> Ha and Hp35

Hairy leaf sheath

Hsp17.3 syn Xttu1935

 

Hsps  >>> I(hsps)

 

Ia >>> I(a)

 

I(a...)

alpha-amylase inhibitor (299)

I(a-BIII)

alpha-amylase inhibitor gene containing 354 nucleotides that encode amino acids (341)

I(Amy) >>> I(a)

Amylase inhibitor

I(as) syn Si  syn Asi  syn Isa

alpha-amylase/subtilisin inhibitor  (299)

I(ae)

Inhibitor of androgenous embryoids wheat-rye  substitutions in vitro (384)

I(hsps)

Suppressor effect on accumulation of HSP18 and HSP70 transcripts

I(et)

Major endosperm trypsin inhibitor

Ibf

Iodine binding factor

I(dha)

Inhibitor of insect alpha-amylase (RDAI)

I(dsc1)15

Dominant inhibitor suppressing desynaptic chromosome pairing (343)

I(ncw)

Inhibitor of novel cell wall formation in wheat (396)

I(scx)37

Secale cereale xylanase inhibitor (411)

Il

Internode length

Isa  syn  I(as)

 

Kn

Number of seeds per spike (361,499)

Kw..., kw...

Thousand-kernel weight (336,499)

Lec syn Xmsu488

 

ln

Light nodes (351)

Ln

Length of second internode

Iph >>> Per >>> Prx

 

La

Anthocyanin in ligule

la

Leafy awn (378)

Lap >>> Amp

 

Lc

Color of leaf

Ldh

Lactate dehydrogenase

lg

Light-green leaf color

ln

Light node

Ln

Number of leaves of stem

lo

Onion-like leaves (379)

Lr136 - Lr syn Pr1

Resistance to leaf (brown) rust (Puccinia recondita, P. dispersa) 6RL (380, 399, 400)

Lr-a

Resistance to leaf rust (Puccinia recondita) 1R

Lr-c

Resistance to leaf rust (Puccinia recondita) 1R

Lr-g

Resistance to leaf rust (Puccinia recondita)

Lra(7)

Resistance to leaf rust (Puccinia recondita), isolate 7 (350)

Lra(12)

Resistance to leaf rust (Puccinia recondita), isolate 12 (350)

Lra(24)

Resistance to leaf rust (Puccinia recondita), isolate24 (486)

Lra(25)

Resistance to leaf rust (Puccinia recondita), isolate25 (350)

Lra(81)

Resistance to leaf rust (Puccinia recondita), isolate 81 (350)

Lra(108)

Resistance to leaf rust (Puccinia recondita), isolate 108 (350)

lu syn cl

Lutescent

Lw

Leaf waxiness

Lys

Lysine

Mal

Malic enzyme

Mas

Mugineic acid synthetase

Mate161

Al-induced citrate transporter gene (494,495)

mc

Monoculm growth habit (374)

Mdh

Malate dehydrogenase

Me

Manganese efficiency

mn55 >>> gd55

Multinodosum, dwarf habit55

mn255

Dwarfness with double increased number of internodes (376)

mo50

Monstrous growth habit (446); showing additional spikelets per spike

mp

Multiple pistils

mrs1 >>> mo1>>> mo

(446)

ms

Male sterility (368)

msh syn Xc, Xs, Xr

mismatch repair gene homologs msh2 syn Xc11; msh3 syn Xs2; msh6 syn Xr2 (456)

mu1 >>> mo

Multiflowered spike (371,446)

N >>> De

 

Nar

Nitrate reductase

Nc

Color of nodes

Nca

Neocentric activity

Ndh

NADH dehydrogenase

Ner 

Hybrid necrosis (124,443)

Ngc

Non-cellulosic glucose content

Nl

Neck length

Nor

Nucleolar organizer region

np55

Nana prostratum, short-stem ‘inch-gitl’

Npg65

Number of pollen grains per anther (502)

ol

Onion accrected leaves

or

Orange

pAWRC.1

3.4 kbp repetitive segment of retrotransposon-like elements (419,420;460) localized within the centromere of rye chromosomes without FISH signal in wheat chromosomes

P(cp) >>> En(cp)

Homoeologous pairing promoter

Pc

Purple culm

pe

Perennial growth habit

P(Edu) >>> En(edu)

Promoter of equational division of univalents

Per syn Prx

Peroxidase

Per syn Xpsr833

 

Pdk1 syn Xhhu1

 

pfs

Partial floret sterility

Pgd

6-phosphogluconate dehydrogenase

Pgi >>> Gpi

 

Pgm

Phosphoglucomutase

Pgt

Parthenogenesis induction

Ph >>> QTL3-5RL

Plant height (499)

Pi

Tolerance to inorganic orthophosphate (Pi) starvation stress  (413)

Pl >>> QTL4-5RL

Peduncle length

Pm

Resistance to powdery mildew

Pm20

Powdery mildew from rye “Prolific” (478); confers a high level of resistance to the Chinese races of Blumeria graminis

pol-r

Mitochondrial gene (323)

Pr3, Pr4, Pr5

Dominant resistance to Puccinia recondita f. sp. secalis (307)

Pr3 >>> Sec4

55-kD-seed protein

Pro

Proline

Prx >>> Per

Peroxidase

Ps syn Vs

Purple seeds

psbD

Coding for components of the reaction center of photosystem II and D2 protein

psbI

Coding for a polypeptide

pSc34 >>> Xpsc34

350-480 bp family from S. cereale

pSc74 >>> Xpsc74

610 bp family from S. cereale

pSc119.2 >>> Xpsc119.2

120 bp family from S. cereale

pSc200 >>> Xpsc200

Highly repetitive sequence from S. cereale

pScJNK1 >>> XpscJNK1

Novel highly repetitive sequence from S. cereale (402)

pScT7 >>> Xpsc77

5S rDNA form S. cereale

PSR154

cDNA clone, by HindIII

pTa71

25S-5.8S-18S rDNA from T. aestivum

Pur-R1 >>> Xpur-R1

 

Py

Yield per plant (361)

q

Speltoid spike

QTL1-2RL, 5RL, 7R

Flowering time, days after sowing (292,302)

QTL2-2R

Number of spikes per plant (292,302)

QTL3-5RL2.3

Plant height of main tillers (292,302,496,499)

QTL4-5RL2.3

Peduncle length of main tillers (292,302)

QTL5-6R

Number of florets per spike of main tillers (292,302,361)

QTL6-2R

Number of grains per spike of main tillers (292,302,361)

QTL7-2R, 5RL

Spike yield of main tillers (302,361)

QTL8-2R

Thousand grain weight (302,499)

QTL9-5RL, 6RL

Straw yield (302)

QTL10-4RL

Rfclb restorer CMS (311)

QTL11-6RS

Rfc2 restorer CMS (311)

QTL12-2R, 4R

Drought tolerance (338)

QTL13-1RS13

Number of seeds per spikelet (in wheat)

QTL14-1RL16

QChc.uas-1R.1,Chc1, Chlorophyll content in leaves (346,404)

QTL15-3RS16

QChc.uas-3R.1, Chc2, Chlorophyll content in leaves (346,404)

QTL16-4RL16

QChc.uas-4R.1,Chc3, Chlorophyll content in leaves (346,404)

QTL17-5RL16

QChc.uas-5R.1, Chc4, Chlorophyll content in leaves (346,404)

QTL18-5RL16

QGar.uas-5R.1, Gar1, Sensitivity of seedlings to gibberellic acid (346,404)

QTL19-1RL16

QGar.uas-1R.1, Gar2, Sensitivity of seedlings to gibberellic acid (346,404)

QTL20-7RL16

QGar.uas-7R.1, Gar3, Sensitivity of seedlings to gibberellic acid (346,404)

QTL21-1RS16

QAbr.uas-1R.1, Abr1, Sensitivity of seedlings to abscisic acids (346,404)

QTL22-2RS16

QAbr.uas-2R.1, Abr2, Sensitivity of seedlings to abscisic acids (346,404)

QTL23-5RL16

QAbr.uas-5R.1, Abr3, Sensitivity of seedlings to abscisic acids (346,404)

QTL24-1RS16

QAmy.uas-1R.1, Amy1-1, Activity of alpha-amylase  (404,407,430)

QTL65-1RS16

QAmy.uas-1R.2, Amy  , Activity of alpha-amylase; marker intervals Xiag95–Xapr1.5, Xubp19–Xem1.27  (430)

QTL88-1RL16

QAmy.uas-1R.1, Amy , Activity of alpha-amylase; marker interval Xapr1.1–Xbcd442  (430)

QTL66-1RL16

QAmy.uas-1R.3, Amy , Activity of alpha-amylase; marker interval Xapr1.12–Xapr1.11 (430)

QTL25-2RS16

QAmy.uas-2R.1, Amy2, Activity of alpha-amylase  (404,407)

QTL67-2RS16

QAmy.uas-2R.2, Amy , Activity of alpha-amylase, marker intervals Xapr2.24–Xapr2.22, Xpsr900–Xem2.10  (430)

QTL75-2RL16

QAmy.uas-2R.3, Amy , Activity of alpha-amylase, marker interval Xapr2.12–Xpsr901  (430); coincides with preharvest sprouting locus Amy1;  marker interval Xpr181-1200–Xis2.1 (473)

QTL26-3RS16

QAmy.uas-3R.1, Amy3, Activity of alpha-amylase  (404,407)

QTL68-3RS16

QAmy.uas-3R.2, Amy , Activity of alpha-amylase, marker interval Xapr3.14–Xapr3.16  (430)

QTL76-3RL16

QAmy.uas-3R.1, Amy , Activity of alpha-amylase; marker interval Xubp20–Xapr3.3 (430) coincides with preharvest sprouting Phs1;  marker interval Xpr665-420–Xis09-500 (473)

QTL27-3RL16

QAmy.uas-3R.2, Amy4, Activity of alpha-amylase  (404,407)

QTL69-4RS16

QAmy.uas-4R.2, Amy , Activity of alpha-amylase, marker interval Xapr4.15–Xapr4.16  (430)

QTL70-4RL16

QAmy.uas-4R.1, Amy , Activity of alpha-amylase; marker interval Xapr4.25–Xapr4.26  (430)

QTL77-4RL16

QAmy.uas-4R.3, Amy , Activity of alpha-amylase; marker interval Xpsr167–Xpsr899  (430)

QTL28-5RS16

QAmy.uas-5R.1, Amy5, Activity of alpha-amylase,   (404,407)

QTL71-5RS16

QAmy.uas-5R.2, Amy , Activity of alpha-amylase; marker intervals Xapr5.13–Xapr5.14, Xpsr1327–Xubp3  (430)

QTL87-5RL16

QAmy.uas-5R.1, Amy , Activity of alpha-amylase, marker interval Xapr5.2–alpha-Amy3, Xapr5.2–alpha-Amy3 (430); coincides with preharvest sprouting Phs2;  marker interval Xpr215-480–Xis43-810 (473)

QTL29-5RL16

QAmy.uas-5R.2, Amy6, Activity of alpha-amylase  (404,407)

QTL72-5RL16

QAmy.uas-5R.3, Amy , Activity of alpha-amylase; marker interval Xapr5.24–Xapr5.2  (430); 5RL =  Xrms1115, Xscm74, Xscm77 (479)

QTL78-6RS16

QAmy.uas-6R.2, Amy , Activity of alpha-amylase; marker interval Xpsr106-1–Xem6.11 (430); coincides with preharvest sprouting Phs3;  marker interval Xapr6.43-–Xapr6.41 (473)

QTL30-6RL16

QAmy.uas-6R.1, Amy7 , Activity of alpha-amylase; marker interval Xscm46–Xapr6.7  (404,407,430)

QTL73-6RL16

QAmy.uas-6R.1, Amy , Activity of alpha-amylase; marker interal Est5–Xpsr454  (430)

QTL74-7RS16

QAmy.uas-7R.2, Amy , Activity of alpha-amylase; marker interval Xopq4a–Xapr7.25 (430)

QTL31-7RL16

QAmy.uas-7R.1, Amy8 Activity of alpha-amylase  (404,407)

QTL32-7RL16

QAmy.uas-7R.2, Amy9 Activity of alpha-amylase  (404,407)

QTL33-3RL

QHt.uas-3R.1, Ht1, Plant height (404,405)

QTL34-5RL

QHt.uas-5R.1, Ht2, Plant height (404,405,496)

QTL35-5RL

QSl.uas-5R.1, Sl1,Spike length (404,405,499)

QTL36-2RL

QTgw.uas-2R.1,Tgw1, Thousand grain weight (404,405,499)

QTL37-3RL

QTgw.uas-3R.1,Tgw2, Thousand grain weight (404,405,499)

QTL38-5RL

QTgw.uas-5R.1,Tgw3, Thousand grain weight (404,405,499)

QTL39-2RS

QKl.uas-2R.1,Kl1, Kernel length (404,405)

QTL40-3RL

QKl.uas-3R.1,Kl1, Kernel length (404,405)

QTL41-5RL

QKl.uas-5R.1,Kl2, Kernel length (404,405)

QTL42-1RS

QKt.uas-1R.1,Kt1, Kernel thickness  (404,405)

QTL43-2RL

QKt.uas-2R.1,Kt2, Kernel thickness  (404,405)

QTL44-3RL

QKt.uas-3R.1,Kt3, Kernel thickness  (404,405)

QTL45-4RS

QKt.uas-4R.1,Kt4, Kernel thickness  (404,405)

QTL46-5RL

QKt.uas-5R.1,Kt5, Kernel thickness  (404,405)

QTL47-4RS

QHd.uas-4R.1,Hd1, Heading time (404,408)

QTL48-5RL

QHd.uas-5R.1,Hd2, Heading time  (404,408,496)

QTL49-2RL

QFl.uas-2R.1,Fl1, Length of flag leaf  (404)

QTL50-4RL

QFl.uas-4R.1,Fl2, Length of flag leaf  (404)

QTL51-3RL

QSinl.uas-3R.1,Sinl1, Length of flag leaf  (404)

QTL52-5RL

QSinl.uas-5R.1,Sinl2, Length of flag leaf  (404)

QTL53-5RS

QSint.uas-5R.1,Sint1, Thickness of 2nd internode (404)

QTL54-7RL

QSint.uas-7R.1,Sint2, Thickness of 2nd internode (404)

QTL55-2RS

QKns.uas-2R.1,Kns1, Number of kernels per spike (404,499)

QTL56-3RL

QKns.uas-3R.1,Kns2, Number of kernels per spike (404,499)

QTL57-5RL

QKns.uas-3R.1,Kns3, Number of kernels per spike (404,499)

QTL58-3RS

QVisc.uas-3R.1,Visc1, Number of kernels per spike (404,406,499)

QTL59-3RS

QVisc.uas-3R.2,Visc2, Number of kernels per spike (404,406,499)

QTL79-1RS16

QPhs.uas-1R.2; Preharvest sprouting; marker interval Xapr1.5–Xapr1.22, Xem1.20–Xem1.27 (430)

QTL60-1RL16

QPhs.uas-1R.1; Preharvest sprouting; Ot1-3,  additive gene action; marker interval Xapr1.18–Xapr1.17 (416,430)

QTL61-2RL16

QPhs.uas-2R.1; Preharvest sprouting; Ot1-3,  dominant gene action; marker interval Xapr2.15–Xapr2.20 (416,430,473)

QTL85-2RL16

QPhs.uas-2R.3; Preharvest sprouting; marker interval Xapr2.12–Xpsr901 (430); coincides with preharvest sprouting locus Amy1;  marker interval Xpr181-1200–Xis2.1 (473)

QTL80-3RS16

QPhs.uas-3R.2; Preharvest sprouting; marker interval Xapr3.14–Xapr3.16 (430); coincides with preharvest sprouting Phs1;  marker interval Xpr665-420–Xis09-500 (473)

QTL81-4RL16

QPhs.uas-4R.1; Preharvest sprouting; marker interval Xapr4.25–Xapr4.26 (430)

QTL82-5RS16

QPhs.uas-5R.2; Preharvest sprouting; marker interval Xapr5.13–Xapr5.14 (430)

QTL86-5RL16

QPhs.uas-5R.3; Preharvest sprouting, marker interval Xmtd862–Dw155 (430)

QTL62-5RL16

QPhs.uas-5R.1; Preharvest sprouting; Ot1-3,  dominant gene action; marker intervals alpha-Amy3–Xis5.1, Xapr5.2alpha-Amy3 (416,430); coincides with preharvest sprouting Phs2;  marker interval Xpr215-480–Xis43-810 (473)

QTL83-6RS16

QPhs.uas-6R.2; Preharvest sprouting; marker interval Xpsr106-1–Xscm112 (430); coincides with preharvest sprouting Phs3;  marker interval Xapr6.43-–Xapr6.41 (473)

QTL63-6RL16

QPhs.uas-6R.1; Preharvest sprouting; Ot1-3,  dominant gene action; marker interval Xscm78–Xapr6.7, Xpsr454–XksuD2 (416,430)

QTL84-7RS16

QPhs.uas-7R.2; Preharvest sprouting; marker interval Xopq4a–Xapr7.25 (430)

QTL64-7RL16

QPhs.uas-7R.1; Preharvest sprouting; Ot1-3,  recessive gene action; marker interval Xapr7.30–Xapr7.31 (416,430)

QTL89-1RS

Rooting ability, the terminal 15% of the rye 1RS arm carries gene(s) for greater rooting ability in wheat (447)

QTL90-7R

Pentosan content, confirmed after test crossing (491)

QTL91-3R

Proein content, confirmed after test crossing (491)

QTL92-5R

Protein content, confirmed after test crossing (491)

QTL93-6R

Protein content, confirmed after test crossing (491)

QTL94-7R

Protein content, confirmed after test crossing (491)

QTL95-1R

Starch content, confirmed after test crossing (491)

QTL96-2R

Starch content, confirmed after test crossing (491)

QTL97-3R

Starch content, confirmed after test crossing (491)

QTL98-5R

Starch content, confirmed after test crossing (491)

QTL99-7R

Starch content, confirmed after test crossing (491)

QTL100-1R

Thousand kernel weight, confirmed after test crossing (491,499)

QTL101-4R

Thousand kernel weight, confirmed after test crossing (491,499)

QTL102-5R

Thousand kernel weight, confirmed after test crossing (491,499)

QTL103-7R

Thousand kernel weight, confirmed after test crossing (491)

QTL104-1R

Test weight, confirmed after test crossing (491)

QTL105-4R

Test weight, confirmed after test crossing (491)

QTL106-5R

Test weight, confirmed after test crossing (491)

QTL107-7R

Test weight, confirmed after test crossing (491)

QTL108-5R

Tissue culture response, negative, immature embryos producing embryogenic callus (493)

QTL109-6R

Tissue culture response, negative, immature embryos producing embryogenic callus (493)

QTL110-1R

Tissue culture response, positive, immature embryos forming embryogenic callus (493)

QTL111-6R

Tissue culture response, positive, immature embryos forming embryogenic callus (493)

QTL112.5RL

Fusarium head blight severty in triticale (48% of variability) (496)

QTL113.3R

Number of spikelets per spike (499), marker XrPt505214, XrPt505592, XrPt506504

QTL114.5R

Number of spikelets per spike (499), marker XrPt347454, XrPt401454, XrPt411244, XrPt411244, XrPt398706

QTL115.4R

Number of kernels per spike (499), marker XrPt116809, XrPt508372, XrPt508372, XrPt509637, XrPt402158, XrPt402158

QTL116.2R

Kernel weight per spike (499), marker Xrpt402364, Xrpt347771, Xrpt401519

QTL117.3R

Kernel weight per spike (499), marker XrPt344420, XrPt507897, XrPt344420

QTL118.4R

Kernel weight per spike (499), marker XrPt116809, XrPt401412, XrPt508372, XrPt390758, XrPt402158, XrPt402158

QTL119.6R

Kernel weight per spike (499), marker XrPt400777, XrPt398472, XrPt400777, XrPt399985, XrPt399985, XrPt399985

QTL120.6R

Thousand kernel weight (499), marker XrPt399985, XrPt399985, XrPt399985

R, R1 >>> An5

 

Rc58

Red coleoptile (476)

rd

Reed growth habit

re

Reduced ear (361)

Reg

Red grain

REV139

Revolver; a transposon-like gene; consists of 2929-3041 bp with an inverted repeated sequence on each end and is dispersed through all seven chromosomes  (422)

Rf syn Rfc

Male fertility restorer

Rfc >>> Rf

Male fertility restorer of the Pampa cytoplasm

Rfg

Male fertility restorer of the Guelzow cytoplasm

Rfp1

Male fertility restorer from Iranian primitive population (313,403)

Rfp2

Male fertility restorer from Argentinean landrace (313,403)

Rga51

Enhanced root growth ability in wheat (447)

rlt141241

cDNA clone from rye “Puma” highest expressed in root tissue conferring information for cold tolerance (424)

rlt142141

cDNA clone from rye “Puma” highest expressed in leaf tissue conferring information for cold tolerance (424)

Rm

Rye mildew

RNAse 

RNAse

Rog

Round grain

rps

Mitochondrial genes (322), encoding the mitochondrial 18S  ribosomal RNA

rps19

 5'-truncated mitochondrial pseudogene co-transcribed with a downstream nad4L gene (340)

rr

Red rachis

rrn

Gene encoding the mitochondrial 18S ribosomal RNA

rs

Reduced seed set

3Rt58

Anthocyanidin-3-glucoside rhamnosyltransferase of anthocyanin biosynthesis pathway (476)

Tcr-n

Tissue culture response, negative (492)

Tcr-p

Tissue culture response, positive (492)

RYS1

A mobile element activated during tissue culture; a foldback (FB) transposon first described in rye and also the first active plant FB transposon reported

S1 >>> a1

Vertical arrangement of leaves (371)

S syn Z

Self-incompatility (353)

S5 syn Sf5

Self-incompatibility

Sa65

Size of antheres (502)

Sbp syn Xpsr804

 

Sc

Color of spike

SCXI >>> I(scx)

 

Sdf

Soluble dietary fiber content

Sec...

Secalin (458)

Sec1

40-55 kDa ω-secalin showing 15 copies of the gene (354,458)

Sec1a >>> Sec1

 

Sec1b >>> Sec1

 

Sec234

40-75 kDa gamma-secalin (458)

Sec3

 

Sec3a >>> Sec3

 

Sec3b >>> Sec3

 

Sec4 syn Gli-R3 syn Pr

 

Sec5

40-75 kDa gamma-secalin (458)

Sf

Self-fertility

Si >>> Asi >>> I(as)

 

Skd

Shikimate dehydrogenase

sl

Plants without spikes and spikelets (372,373)

Sl

Length of spike (361,499)

sl syn sp

Spreading leaf

Sn

Number of spikelets per spike (361,499)

Sod

Superoxide dismutase

sp >>> sl

 

Sp syn Sp1 syn Vrn

Spring growth habit (361,362,438)

Spf  >>> QTL13-1RS13 

Spikelet fertility (207,361)

Sr  

Resistance to stem rust (Puccinia graminis) (380)

Sr31

Resistance to stem rust (Puccinia graminis f. sp. tritici) in 1AL.1RS translocated wheat ‘Amigo’ = ‘Insave’ rye (389)

sr >>> dr

 

ss1 syn Xpsr490

 

Ss2 syn Xpsr489

 

SsI(Ta)

Soluble starch synthetase I transporter gene (SSI) (363)

Ssp...12

Salt-soluble protein (299)

Su(cp)

Homoeologous pairing suppressor

Su(hsp)

Suppressor of heat shock proteins of wheat

Sut(Ta)

Sucrose transporter gene wheat, homoeologous group 4

Sw

Stem waxiness

sy >>> syn

 

sy1 = syn1 = asc115

(182,343,359); affects recombination events

sy2 = dsc115

 

sy3 = asc415

Weak asynaptic mutant (345)

sy2a = dsc215

 

sy2b = dsc315

 

sy6

Causing nonhomologous synapsis (345)

sy7

Causing nonhomologous synapsis (345)

sy8

Causing nonhomologous synapsis (345)

sy9 = asc215

connected with defects of the assembly of synaptonemal complex axial cores (474)

sy10 = asc315,32

Causing nonhomologous synapsis (345,359); coupled with the presence of protein Zyp1 in the core region. The assembly of proteins Asy1 and Zyp1 on the axes of meiotic chromosomes was shown to occur separately, which is a specific feature of rye, as compared to arabidopsis (474)

sy19

Impairs the homology of meiotic chromosome synapsis (488)

syn >>> asc or dsc

 

T

Self-incompatility (353)

Ta(Almt1)42

Aluminum-activated malate transporter renamed by the authors from TaALMT1; identical or closely linked with the Alt4 locus (409,429)

TAM... >>> Xtam...

 

TBP5L/4L

Evolutionary translocation break point 5RL/4RL in rye (476)

TBP6L/3L

Evolutionary translocation break point 6RL/3RL in rye (476)

Tc

Color of tillers

Tc427

(363)

Tcr-p

Positive tissue culture response (492)

td

Disturbed tetrade formation

tg

Tulip growth habit

Thi

Thionin

ti 

Tigrina

Tp

Transposition

Tpi

Triosephosphate isomerase

trnS

Coding for tRNASer (GCU)

Tr

Translocation breakpoint

Tw

Thousand grain weight (363, 425)

Tw125

Thousand grain weight (363, 425) on chromosome 5R

Tw225

Thousand grain weight (363, 425) on chromosome 7R

Tyr

Tyrosinase

tys

transversal yellow strips on leaf (484); lethal chlorophyll mutant

Uba syn Xpsr860

 

ug

Production of unreduced gamtes in diploid rye (394); named by the author

V >>> Hg

 

va

Viridoalbina

vb >>> vi

Viridis

Vdac1 syn Xtav1961

 

Vdac2 syn Xtav1960

 

vi syn an

Viridis, virescent, anthocyaninless

vi1 >>> an1

 

Vrn >>> Sp

 

Vs >>> Ps

Violet seeds

w >>> wa 1

Waxless plant with waxy nodes

wa syn epr

 

wa1

Waxless plant

wg syn es

Waxless glume

WG... >>> Xwg...

 

wh

White

whg

White glume

Wsm...

Resistance to wheat streak mosaic virus

Wsp...

Water-soluble proteins (412)

wx >>> wa164

Waxy endosperm (455,501)

X5s...

STS marker

xa

Xantha

Xabc...

cDNA clones of barley (439)

Xabc160

(439)

Xabc160u

(439)

Xabc161

(439)

Xabc310

(439)

Xabc310.1

(439)

Xabc454u

(439)

Xabc465

(439)

Xabg463

(439)

XAcl2

pLH/ACPII/1

XAdh

RFLP, DNA clone p3NTR, function: 3’untranslated region of  Adh1A, copy number:1

XAdpg2 

pSh2.25; ADP glucose pyrophosphorylase

Xalpha-Amy1

RFLP, cDNA clone of wheat gene alpha-Amy1 (AMY-46)

Xalpha-Amy2

RFLP, cDNA clone of wheat gene alpha-Amy2 (AMY 4848)

Xalpha-Amy3

RFLP, cDNA clone of wheat gene alpha-Amy3 (AMY 33)

Xapr...

Arbitrary primer for rye genome mapping, RAPD (299,355)

Xapr1.1

RAPD marker, primer GACTACGGGG, 1600 bp fragment (412)

Xapr1.2

RAPD marker, primer CCGAATTCCC, 1400 bp fragment (412)

Xapr1.3

RAPD marker, primer ACGCCCAGAC, 520 bp fragment (412)

Xapr1.4

RAPD marker, primer TGGATCCGC, 550 bp fragment (412)

Xapr1.5

RAPD marker, primer GCACGTAGAT, 950 bp fragment (412)

Xapr1.6

RAPD marker, primer ACTCACTACA, 850 bp fragment (412)

Xapr1.7

RAPD marker, primer ACTCACTACA, 1030 bp fragment (412)

Xapr1.8

RAPD marker, primer CAGCCTACCT, 500 bp fragment (355,412)

Xapr1.9

RAPD marker, primer GTAGCCGTCT, 370 bp fragment (355,412)

Xapr1.10

RAPD marker, primer GTAGCCGTCT, 750 bp fragment (355), ACTCACTACA, 750 bp fragment (,412)

Xapr1.11

RAPD marker, primer CTGCTGGGAC, 590 bp fragment (412)

Xapr1.12

RAPD marker, primer AACGAATGCC, 870 bp fragment (412)

Xapr1.13

RAPD marker, primer CGGCTGACTT, 900 bp fragment (412)

Xapr1.14

RAPD marker, primer CACAGCGATA, 700 bp fragment (412)

Xapr1.15

RAPD marker, primer GTGTACGGAT, 1100 bp fragment (412)

Xapr1.16

RAPD marker, primer CTCACCGTCC, 590 bp fragment (412)

Xapr1.17

RAPD marker, primer TCTCTGCGCT, 850 bp fragment (412)

Xapr1.18

RAPD marker, primer TGCCCGTCGT, 900 bp fragment (412)

Xapr1.19

RAPD marker, primer TCACAGACGC, 740 bp fragment (412)

Xapr1.20

RAPD marker, primer TCGCCAGAGT, 1000 bp fragment (412)

Xapr1.21

RAPD marker, primer TGCTCGGTTC, 1100 bp fragment (412)

Xapr2.1

RAPD marker, primer TGTCCAGCTT, 1200 bp fragment (412)

Xapr2.2

RAPD marker, primer TCGCCCCATT, 900 bp fragment (412)

Xapr2.3

RAPD marker, primer AGTTCGTCTG, 1000 bp fragment (412)

Xapr2.4

RAPD marker, primer GTCCACACGG, 400 bp fragment (412)

Xapr2.5

RAPD marker, primer CTCACCGTCC, 750 bp fragment (412)

Xapr2.6

RAPD marker, primer TGCGGCTGAG, 650 bp fragment (412)

Xapr2.7

RAPD marker, primer GCAACTACGT, 1200 bp fragment (412)

Xapr2.8

RAPD marker, primer CTCGAGGTAA, 1030 bp fragment (412)

Xapr2.9

RAPD marker, primer GAGGATCCCT, 570 bp fragment (412)

Xapr2.10

RAPD marker, primer TCCGACAAGA, 450 bp fragment (412)

Xapr2.11

RAPD marker, primer CACCATCCAA, 840 bp fragment (412)

Xapr2.12

RAPD marker, primer CTCACCGTCC, 1100 bp fragment (412)

Xapr2.13

RAPD marker, primer TGCCCTGCGT, 1200 bp fragment (412)

Xapr2.14

RAPD marker, primer TCGCCAGAGT, 1550 bp fragment (412)

Xapr2.15

RAPD marker, primer ACGCGCATGT, 950 bp fragment (412)

Xapr2.16

RAPD marker, primer TAGCGGCTAG, 480 bp fragment (412)

Xapr2.17

RAPD marker, primer TCTCTGCGCT, 400 bp fragment (412)

Xapr2.18

RAPD marker, primer CCGAGTCAAA, 490 bp fragment (412)

Xapr2.19

RAPD marker, primer GTGTAAGCCG, 1000 bp fragment (412

Xapr2.20

RAPD marker, primer GCACGTAGAT, 490 bp fragment (412)

Xapr2.21

RAPD marker, primer GAACTCCGCT, 900 bp fragment (412)

Xapr2.22

RAPD marker, primer TCGCCAGAGT,490 bp fragment (412)

Xapr2.23

RAPD marker, primer CGCGCACAAT, 960 bp fragment (412)

Xapr2.24

RAPD marker, primer GGTCGGAGAA, 650 bp fragment (412)

Xapr3.1

RAPD marker, primer CCCTACCGAC, 550 bp fragment (412)

Xapr3.2

RAPD marker, primer AACGCGTTCT, 2000 bp fragment (412)

Xapr3.3

RAPD marker, primer CGTACGGATA, 2000 bp fragment (412)

Xapr3.4

RAPD marker, primer ACGGTACCAG, 850 bp fragment (412)

Xapr3.5

RAPD marker, primer CGTCGGAGAA, 539 bp fragment (412)

Xapr3.6

RAPD marker, primer ATGGATCCGC, 870 bp fragment (412)

Xapr3.7

RAPD marker, primer CAAACGTCGC, 700 bp fragment (412)

Xapr3.8

RAPD marker, primer CACAGCTGCG, 750 bp fragment (355,412)

Xapr3.9

RAPD marker, primer CACAGCGAAA, 450 bp fragment (355,412)

Xapr3.10

RAPD marker, primer ACCTCAGCCT, 450 bp fragment (355,412)

Xapr3.11

RAPD marker, primer GGGAACTGAT, 800 bp fragment (412)

Xapr3.12

RAPD marker, primer CATCCCCCTG, 1200 bp fragment (412)

Xapr3.13

RAPD marker, primer CATCCCCCTG, 1150 bp fragment (412)

Xapr3.14

RAPD marker, primer TTGCGGAGAA, 520 bp fragment (412)

Xapr3.15

RAPD marker, primer GTTTCGCTGG, 460 bp fragment (412)

Xapr3.16

RAPD marker, primer AGGAGACTGG, 830 bp fragment (412)

Xapr3.17

RAPD marker, primer CCGTCGCCTA, 670 bp fragment (412)

Xapr3.18

RAPD marker, primer AAGCACCGGC, 450 bp fragment (412)

Xapr3.19

RAPD marker, primer CAGACGGTGT, 880 bp fragment (412)

Xapr3.20

RAPD marker, primer CCTTGACGCA, 430 bp fragment (412)

Xapr3.21

RAPD marker, primer CACAGCGAAT, 800 bp fragment (412)

Xapr4.1

RAPD marker, primer CGTCTGGGAA, 900 bp fragment (412)

Xapr4.2

RAPD marker, primer CCTTGCAACT, 850 bp fragment (412)

Xapr4.3

RAPD marker, primer TCAGCCCCTG, 800 bp fragment (412)

Xapr4.4

RAPD marker, primer GCACGTAGAT, 500 bp fragment (412)

Xapr4.5

RAPD marker, primer AACGGTGACC, 750 bp fragment (412)

Xapr4.6

RAPD marker, primer AACGGTGACC, 1600 bp fragment (412)

Xapr4.7

RAPD marker, primer CCGAATTCCC, 1100 bp fragment (412)

Xapr4.8

RAPD marker, primer GTGATCGCAG, 530 bp fragment (412)

Xapr4.9

RAPD marker, primer GGTCTAGAGG, 910 bp fragment (412)

Xapr4.10

RAPD marker, primer GGTCTAGAGG, 800 bp fragment (412)

Xapr4.11

RAPD marker, primer ATGACGTTGA, 830 bp fragment (412)

Xapr4.12

RAPD marker, primer GGACTGGAGT, 900 bp fragment (412)

Xapr4.13

RAPD marker, primer CACAGCGAAA, 700 bp fragment (355)

Xapr4.14

RAPD marker, primer CCGAGTCAAA, 650 bp fragment (412)

Xapr4.15

RAPD marker, primer CGATAGCGGA, 700 bp fragment (412)

Xapr4.16

RAPD marker, primer TGGCGTCCAG, 450 bp fragment (412)

Xapr4.17

RAPD marker, primer AACGGTGACC, 820 bp fragment (412)

Xapr4.18

RAPD marker, primer CACTCTCCTC, 700 bp fragment (412)

Xapr4.19

RAPD marker, primer GGGTTGCCGA, 800 bp fragment (412)

Xapr4.20

RAPD marker, primer GGATGCATGT, 1800 bp fragment (412)

Xapr4.21

RAPD marker, primer ACGCGCATGT, 1200 bp fragment (412)

Xapr4.22

RAPD marker, primer CTCGGCTGAA, 400 bp fragment (412)

Xapr4.23

RAPD marker, primer CATGTAGACC, 800 bp fragment (412)

Xapr4.24

RAPD marker, primer GTGTACGGAT,1800 bp fragment (412)

Xapr4.25

RAPD marker, primer GTGACGTAGG, 710 bp fragment (412)

Xapr4.26

RAPD marker, primer AGATGCAGCC, 750 bp fragment (412)

Xapr4.27

RAPD marker, primer GGGTCCCTTG, 840 bp fragment (412)

Xapr4.28

RAPD marker, primer AACGCGTTCT, 1700 bp fragment (412)

Xapr4.29

RAPD marker, primer AGTATCGACC, 750 bp fragment (412)

Xapr5.1

RAPD marker, primer CCACTGTTAG, 350 bp fragment (412)

Xapr5.2

RAPD marker, primer AGAGATCTCC, 430 bp fragment (412)

Xapr5.3

RAPD marker, primer CTTCACCCGA, 350 bp fragment (412)

Xapr5.4

RAPD marker, primer CTTCACCCGA, 540 bp fragment (412)

Xapr5.5

RAPD marker, primer AACGCGTTCT, 460 bp fragment (412)

Xapr5.6

RAPD marker, primer GACTACGGGG, 500 bp fragment (412)

Xapr5.7

RAPD marker, primer TCTCAGCTGG, 650 bp fragment (412)

Xapr5.8

RAPD marker, primer GGGCCACGCT, 840 bp fragment (412)

Xapr5.9

RAPD marker, primer AGAATCGGGG, 520 bp fragment (412)

Xapr5.10

RAPD marker, primer ACGTAGCGAT, 900 bp fragment (355)

Xapr5.11

RAPD marker, primer CAGCCTACCG, 950 bp fragment (355)

Xapr5.12

RAPD marker, primer CGGTCCAGGC, 420 bp fragment (412)

Xapr5.13

RAPD marker, primer GACTCCCGTT, 850 bp fragment (412)

Xapr5.14

RAPD marker, primer AGCGCGTAAG, 1900 bp fragment (412)

Xapr5.15

RAPD marker, primer CCTCTGCCCC, 770 bp fragment (412)

Xapr5.16

RAPD marker, primer GATTTCTGCT, 700 bp fragment (412)

Xapr5.17

RAPD marker, primer CACAGCCAGT, 700 bp fragment (412)

Xapr5.18

RAPD marker, primer CGTCGCGTCA, 1400 bp fragment (412)

Xapr5.19

RAPD marker, primer CACAGCGACT, 940 bp fragment (412)

Xapr5.20

RAPD marker, primer CGAATCGCGC, 850 bp fragment (412)

Xapr5.21

RAPD marker, primer GGTCGGAGAT, 1300 bp fragment (412)

Xapr5.22

RAPD marker, primer ACGGTACCAG, 540 bp fragment (412)

Xapr5.23

RAPD marker, primer GGTCCCTGAC, 510 bp fragment (412)

Xapr5.24

RAPD marker, primer GGTCCCTGAC, 1200 bp fragment (412)

Xapr5.25

RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)

Xapr6.1

RAPD marker, primer GTCCCGACGA, 750 bp fragment (412)

Xapr6.2

RAPD marker, primer TCCGCGGTCT, 750 bp fragment (412)

Xapr6.3

RAPD marker, primer AGGGTGTACG, 350 bp fragment (412)

Xapr6.4

RAPD marker, primer GTGATCGCAG, 1200 bp fragment (412)

Xapr6.5

RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)

Xapr6.6

RAPD marker, primer AGATGCAGCC, 580 bp fragment (412)

Xapr6.7

RAPD marker, primer CGTCTAGAGG,  510 bp fragment (412)

Xapr6.8

RAPD marker, primer ACGATGAGCT, 590 bp fragment (412)

Xapr6.9

RAPD marker, primer GTGATCGCTG, 460 bp fragment (412)

Xapr6.10

RAPD marker, primer ACCTCAGCCA, 500 bp fragment (355)

Xapr6.11

RAPD marker, primer CGTCGCGTCA, 1200 bp fragment (355)

Xapr6.12

RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)

Xapr6.13

RAPD marker, primer CGGGATGTTA, 440 bp fragment (412)

Xapr6.14

RAPD marker, primer CCACACACAA, 440 bp fragment (412)

Xapr6.15

RAPD marker, primer ATGACGTTGA, 640 bp fragment (412)

Xapr6.16

RAPD marker, primer CCAGGGTGTT, 840 bp fragment (412)

Xapr6.17

RAPD marker, primer ACTGGATCGT, 210 bp fragment (412)

Xapr6.18

RAPD marker, primer ACTGGATCGT, 600 bp fragment (412)

Xapr6.19

RAPD marker, primer GAACGACGCA, 670 bp fragment (412)

Xapr6.20

RAPD marker, primer GTGTAAGCCG, 620 bp fragment (412)

Xapr6.21

RAPD marker, primer CCTTGACGCA, 1400 bp fragment (412)

Xapr6.22

RAPD marker, primer CTGTAGCCGG, 490 bp fragment (412)

Xapr6.23

RAPD marker, primer GAACTCCGCT, 410 bp fragment (412)

Xapr6.24

RAPD marker, primer CAGCACCCAT, 630 bp fragment (412)

Xapr6.25

RAPD marker, primer CTCGAGGTAA, 390 bp fragment (449)

Xapr6.26

RAPD marker, primer ACCTCAGCGT, 550 bp fragment (449)

Xapr6.27

RAPD marker, primer GTAGCCGTCT, 700 bp fragment (449)

Xapr6.28

RAPD marker, primer AGGAGACTGG, 260 bp fragment (449)

Xapr6.29

RAPD marker, primer CCGTTCCAAA, 900 bp fragment (449)

Xapr6.30

RAPD marker, primer AACCCACCCG, 650 bp fragment (449)

Xapr6.31

RAPD marker, primer GCGCGATAAG, 600 bp fragment (449)

Xapr6.32

RAPD marker, primer CGTGATAAGG, 670 bp fragment (449)

Xapr6.33

RAPD marker, primer CCCAAGTCAT, 1300 bp fragment (449)

Xapr6.34

RAPD marker, primer ATGTGTGTGG, 530 bp fragment (449)

Xapr6.35

RAPD marker, primer GGAGTGTGTA, 1000 bp fragment (449)

Xapr6.36

RAPD marker, primer GGAGTGTGTA, 750 bp fragment (449)

Xapr6.37

RAPD marker, primer CTGTAGCCGG, 750 bp fragment (449)

Xapr6.38

RAPD marker, primer ACCCCCCACG, 620 bp fragment (449)

Xapr6.39

RAPD marker, primer CTGAGACGGA, 480 bp fragment (449)

Xapr6.40

RAPD marker, primer ACCTCCAGCG, 1030 bp fragment (449)

Xapr6.41

RAPD marker, primer CCGCCTAGTC, 900 bp fragment (449)

Xapr6.42

RAPD marker, primer CCTCTGCCCA, 650 bp fragment (449)

Xapr6.43

RAPD marker, primer CGCCCCCAGC, 430 bp fragment (449)

Xapr6.44

RAPD marker, primer CAAGCGGATC, 950 bp fragment (449)

Xapr6.45

RAPD marker, primer CAGCCTACAG, 600 bp fragment (449)

Xapr6.46

RAPD marker, primer GTCCGTTGGG, 650 bp fragment (449)

Xapr6.47

RAPD marker, primer GACAAAGAGG, 550 bp fragment (449)

Xapr6.48

RAPD marker, primer AAGCCTCGTC, 1700 bp fragment (449)

Xapr6.49

RAPD marker, primer CAGTCGCGTG, 1400 bp fragment (449)

Xapr6.50

RAPD marker, primer TGTCCAGCTT, 710 bp fragment (449)

Xapr6.51

RAPD marker, primer GCCATAAGCG, 920 bp fragment (449)

Xapr6.52

RAPD marker, primer ACGAAGCTAA, 500 bp fragment (449)

Xapr6.53

RAPD marker, primer CCACGCTATA, 600 bp fragment (449)

Xapr6.54

RAPD marker, primer ACATGTTCGG, 1700 bp fragment (449)

Xapr6.55

RAPD marker, primer CCTCTCGCAA, 410 bp fragment (449)

Xapr6.56

RAPD marker, primer CGGCCCACGT, 690 bp fragment (449)

Xapr6.57

RAPD marker, primer TGCAGTTAGT, 730 bp fragment (449)

Xapr6.58

RAPD marker, primer GGGTAACGCA, 1100 bp fragment (449)

Xapr7.1

RAPD marker, primer TGTCCAGCTT, 400 bp fragment (412)

Xapr7.2

RAPD marker, primer GTCCCGACGA, 350 bp fragment (412)

Xapr7.3

RAPD marker, primer TGCCGCTAAG, 900 bp fragment (412)

Xapr7.4

RAPD marker, primer TCGCGCTGTC, 700 bp fragment (412)

Xapr7.5

RAPD marker, primer GTGTACGGAT, 800 bp fragment (412)

Xapr7.6

RAPD marker, primer GTGATCGCAG, 330 bp fragment (412)

Xapr7.7

RAPD marker, primer TGCCCGTCGT, 750 bp fragment (412)

Xapr7.8

RAPD marker, primer GGATGAGACC, 660 bp fragment (412)

Xapr7.9

RAPD marker, primer TCCCGAACCG, 830 bp fragment (412)

Xapr7.10

RAPD marker, primer GGGCCACGCT, 1400 bp fragment (412)

Xapr7.11

RAPD marker, primer ACGCCCAGGG, 1350 bp fragment (412)

Xapr7.12

RAPD marker, primer ACGCCCAGGG, 650 bp fragment (412)

Xapr7.13

RAPD marker, primer CCTCTGCCCA, 1100 bp fragment (412)

Xapr7.14

RAPD marker, primer TCAGAGCGCC, 900 bp fragment (355,412)

Xapr7.15

RAPD marker, primer CAGCCTACCT, 850 bp fragment (355,412)

Xapr7.16

RAPD marker, primer CACAGCGAAT, 1500 bp fragment (355,412)

Xapr7.17

RAPD marker, primer CCAGGGTGAC, 1300 bp fragment (355,412)

Xapr7.18

RAPD marker, primer TTAGCCGATC, 960 bp fragment (355,412)

Xapr7.19

RAPD marker, primer CCTCTCGCAA, 550 bp fragment (355,412)

Xapr7.20

RAPD marker, primer CAGTCTCGTC, 1500 bp fragment (355,412)

Xapr7.21

RAPD marker, primer CGTCGCGTCA, 1200 bp fragment (355,412)

Xapr7.22

RAPD marker, primer GGGCTGACTT, 350 bp fragment (412)

Xapr7.23

RAPD marker, primer CAGCACCCAT, 660 bp fragment (412)

Xapr7.24

RAPD marker, primer CACAGCGAAT, 490 bp fragment (412)

Xapr7.25

RAPD marker, primer CGCATTACGC, 1050 bp fragment (412)

Xapr7.26

RAPD marker, primer GGTCGGAGAT, 980 bp fragment (412)

Xapr7.27

RAPD marker, primer CCACACACTA, 500 bp fragment (412)

Xapr7.28

RAPD marker, primer TAGACGTCGC, 1350 bp fragment (412)

Xapr7.29

RAPD marker, primer AGCCTGTGTG, 550 bp fragment (412)

Xapr7.30

RAPD marker, primer TTGGGCTGAC, 350 bp fragment (412)

Xapr7.31

RAPD marker, primer CCTCTGCCCA, 1100 bp fragment (412)

Xapr7.32

RAPD marker, primer ACGCCCAGGG, 500 bp fragment (412)

Xapr7.33

RAPD marker, primer CTCCGTTGGG, 1350 bp fragment (412)

Xapr7.34

RAPD marker, primer GACACGTCTG, 780 bp fragment (412)

Xapr7.35

RAPD marker, primer CCTCTGCCCA, 780 bp fragment (412)

Xapr7.36

RAPD marker, primer CCCTACCGAC, 1500 bp fragment (412)

Xapr7.37

RAPD marker, primer CTCACCGTCC, 1700 bp fragment (412)

Xapr7.38

RAPD marker, primer GGTCGGAGAA, 1000 bp fragment (412)

Xbeta-Amy

RFLP, cDNA clone pc betac51 of barley

Xb....

RFLP markers (328,410)

Xb1f

Primer sequence GGT GCA TTT CTG GTG GC (410)

Xb4f

Primer sequence CGGGTAAACAAATTACTGTCGAG (410)

XbaI

Probe for labelling two chromosomes 1R and ?? (482)

X26f

Primer sequence TAGCGGCGAGAAGATGGTGGTGTG (410)

Xbcd...

RFLP,cDNA clones of barley and rye (410,439)

Xbcd1

RFLP, cDNA clone, by EcoRV

Xbcd102

RFLP, cDNA clone, by DraI

Xbcd269

RFLP, cDNA clone, by XbaI

Xbcd276

RFLP, cDNA clone, by DraI

Xbcd304

(439)

Xbcd340

RFLP, cDNA clone, by EcoRI

Xbcd508

RFLP, cDNA clone, by EcoRI

Xbcd758

RFLP, cDNA clone, by EcoRV

Xbcd828

(439)

Xbcd1230f

Primer sequence TACTTGCGTAAGACACAGTTAGAA (410)

Xbcd1230r

Primer sequence GCGACTCACGAAAGATTGGT (410)

Xbcd1426

RFLP, cDNA clone, by EcoRV

Xbmac...

SSR marker of barley origin (331,471)

Xcat    

RFLP, pCat2.1c

Xcdo...

RFLP, cDNA clones of oat (439)

Xcdo36

(439)

Xcdo419

RFLP, cDNA clone, by EcoRI

Xcdo497

RFLP, cDNA clone, by EcoRV

Xcdo676

RFLP, cDNA clone, by DraI

Xcdo749

(439)

Xcdo772

RFLP, cDNA clone, by EcoRV

Xcdo1091

RFLP, cDNA clone, by EcoRV

Xcdo1380

RFLP, cDNA clone, by EcoRV

Xcdo1400

cRFLP, DNA clone, by DraI

Xcinau142

EST marker, primer CCCTATTATGGACAACGACG CCCTATTATGGACAACGACG (477)

Xcinau143

EST marker primer CTTCAACCAATGGCAACTCA TCAAGGAACGGATCAACAGG  (477)

Xcinau145

EST marker primer ATCCTGTTACCCAGTATCTACCT ATGTTCCATTTCTGCTCCAA  (477)

Xcinau146

EST marker primer TCCACACCGAGTGGTACAAG ACGGCAGTTCATCCCCTAC  (477)

Xcinau346

EST marker primer CGCGTCCTCGATACCTGT GCCACACTGAGTTGACAAACA  (477)

Xcinau450

EST marker primer TCGACACGAGCAAGATTCAC GTCAGCGTTGAGGAGAGACC  (477)

Xcinau660

EST marker primer TTCGGTATCGTCGTCTCGT CAAGTCATCGCCAGTTCCA  (477)

Xcinau895

EST marker primer GCTTTGCCTCAGTATGTC GTGATCCCGAAGTTTGTT  (477)

Xcmwg652

(439)

Xcmwg660

(439)

Xcmwg682

(439)

Xcmwg699

(439)

Xcmwg720

(439)

Xcxp1

RFLP, Clone pLamdac.3, function: carboxy-peptidase-1

Xcs...

RFL, DNA clones

Xcslrgh3 ...

RFLP,  marker (330)

Xd.....

DArT markers (Diversity Arrays Technology, microarray-based method allowing for detection of DNA polymorphism at several thousand loci in a single assay without relying on DNA sequence information) (457)

Xem1

RFLP, DNA clone p1015, function: early-methionine-labelled polypeptide, copy number:3

Xem1.1

AFLP marker, primer EAAAMCGG, 220 bp fragment (355,412)

Xem1.2

AFLP marker, primer EAAAMCGG, 48 bp fragment (355,412)

Xem1.3

AFLP marker, primer EAACMCTG, 92 bp fragment (355)

Xem1.4

AFLP marker, primer EAACMCTG, 113 bp fragment (355,412)

Xem1.5

AFLP marker, primer EAACMCTG, 142 bp fragment (355,412)

Xem1.6

AFLP marker, primer EAAGMCCG, 178 bp fragment (355,412)

Xem1.7

AFLP marker, primer EAAGMCCG, 199 bp fragment (355,412)

Xem1.8

AFLP marker, primer EAAGMCCG, 218 bp fragment (355,412)

Xem1.9

AFLP marker, primer EAATMCGA, 187 bp fragment (355,412)

Xem1.10

AFLP marker, primer EAATMCGA, 229 bp fragment (355,412)

Xem1.11

AFLP marker, primer EAATMCGT, 140 bp fragment (355,412)

Xem1.12

AFLP marker, primer EAATMCGT, 172 bp fragment (355,412)

Xem1.13

AFLP marker, primer EAATMCTG, 170 bp fragment (355,412)

Xem1.14

AFLP marker, primer EACAMCGG, 143 bp fragment (355,412)

Xem1.15

AFLP marker, primer EACAMCGG, 306 bp fragment (355,412)

Xem1.16

AFLP marker, primer EACAMCTG, 198 bp fragment (355,412)

Xem1.17

AFLP marker, primer EACCMCGC, 156 bp fragment (355,412)

Xem1.18

AFLP marker, primer EACCMCGG, 128 bp fragment (355,412)

Xem1.19

AFLP marker, primer EACCMCGG, 134 bp fragment (355,412)

Xem1.20

AFLP marker, primer EACCMCGG, 200 bp fragment (355,412)

Xem1.21

AFLP marker, primer EACCMCTT, 121 bp fragment (355,412)

Xem1.22

AFLP marker, primer EACCMCTT, 177 bp fragment (355,412)

Xem1.23

AFLP marker, primer EAGCMCAA, 123 bp fragment (355,412)

Xem1.24

AFLP marker, primer EAGCMCAA, 233 bp fragment (355,412)

Xem1.25

AFLP marker, primer EAGGMCCG, 159 bp fragment (355,412)

Xem1.26

AFLP marker, primer EAGTMCAA, 205 bp fragment (355,412)

Xem1.27

AFLP marker, primer EAGTMCCT, 189 bp fragment (355,412)

Xem1.28

AFLP marker, primer EAGTMCTT, 131 bp fragment (355,412)

Xem1.29

AFLP marker, primer EATGMCGG, 141 bp fragment (355,412)

Xem1.30

AFLP marker, primer EATGMCGG, 160 bp fragment (355)

Xem1.31

AFLP marker, primer EATGMCGG, 181 bp fragment (355,412)

Xem1.32

AFLP marker, primer EATTMCTT, 201 bp fragment (355,412)

Xem1.33

AFLP marker, primer EAGGMCAG, 152 bp fragment (355)

Xem1.34

AFLP marker, primer EAGGMCAG, 243 bp fragment (355)

Xem1.35

AFLP marker, primer EAGGMCAG, 286 bp fragment (355)

Xem1.36

AFLP marker, primer EAGGMCAG, 308 bp fragment (355,412)

Xem2.1

AFLP marker, primer EAAAMCGG, 101 bp fragment (355)

Xem2.2

AFLP marker, primer EAAAMCGG, 107 bp fragment (355)

Xem2.3

AFLP marker, primer EAACMCCC, 266 bp fragment (355)

Xem2.4

AFLP marker, primer EAAGMCCT, 157 bp fragment (355)

Xem2.5

AFLP marker, primer EAATMCTG, 167 bp fragment (355)

Xem2.6

AFLP marker, primer EACAMCGG, 215 bp fragment (355)

Xem2.7

AFLP marker, primer EACAMCTG, 99 bp fragment (355)

Xem2.8

AFLP marker, primer EACCMCGC, 129 bp fragment (355)

Xem2.9

AFLP marker, primer EACCMCGC, 196 bp fragment (355)

Xem2.10

AFLP marker, primer EACTMCCG, 294 bp fragment (355)

Xem2.11

AFLP marker, primer EAGCMCAA, 239 bp fragment (355)

Xem2.12

AFLP marker, primer EAGCMCGC, 282 bp fragment (355)

Xem2.13

AFLP marker, primer EAGGMCCG, 194 bp fragment (355)

Xem2.14

AFLP marker, primer EAGGMCCG, 222 bp fragment (355)

Xem2.15

AFLP marker, primer EAGGMCTG, 108 bp fragment (355)

Xem2.16

AFLP marker, primer EAGTMCGG, 169 bp fragment (355)

Xem2.17

AFLP marker, primer EAGTMCTT, 215 bp fragment (355)

Xem2.18

AFLP marker, primer EATGMCGG, 144 bp fragment (355)

Xem2.19

AFLP marker, primer EATTMCTT, 152 bp fragment (355)

Xem2.20

AFLP marker, primer EACCMCTG, 220 bp fragment (355)

Xem2.21

AFLP marker, primer EACCMCTG, 205 bp fragment (355)

Xem2.22

AFLP marker, primer EACCMCTG, 209 bp fragment (355)

Xem2.23

AFLP marker, primer EACGMCAG, 131 bp fragment (355)

Xem2.24

AFLP marker, primer EAGGMCAG, 159 bp fragment (355)

Xem2.25

AFLP marker, primer EAGGMCAG, 166 bp fragment (355)

Xem2.26

AFLP marker, primer EAGGMCAG, 232 bp fragment (355)

Xem2.27

AFLP marker, primer EAGGMCAG, 265 bp fragment (355)

Xem2.28

AFLP marker, primer EAGGMCAG, 290 bp fragment (355)

Xem3.1

AFLP marker, primer EAAAMCAT, 114 bp fragment (355)

Xem3.2

AFLP marker, primer EAAGMCCG, 219 bp fragment (355)

Xem3.3

AFLP marker, primer EAATMCTG, 147 bp fragment (355)

Xem3.4

AFLP marker, primer EAATMCTG, 164 bp fragment (355)

Xem3.5

AFLP marker, primer EAATMCGA, 285 bp fragment (355)

Xem3.6

AFLP marker, primer EAATMCTG, 204 bp fragment (355)

Xem3.7

AFLP marker, primer EACAMCGG, 152 bp fragment (355)

Xem3.8

AFLP marker, primer EACAMCTG, 178 bp fragment (355)

Xem3.9

AFLP marker, primer EACCMCGC, 209 bp fragment (355)

Xem3.10

AFLP marker, primer EACCMCGG, 90 bp fragment (355)

Xem3.11

AFLP marker, primer EACCMCTT, 101 bp fragment (355)

Xem3.12

AFLP marker, primer EACGMCCG, 114 bp fragment (355)

Xem3.13

AFLP marker, primer EACTMCCG, 159 bp fragment (355)

Xem3.14

AFLP marker, primer EAGGMCCG, 135 bp fragment (355)

Xem3.15

AFLP marker, primer EAGGMCCG, 175 bp fragment (355)

Xem3.16

AFLP marker, primer EAGGMCGG, 131 bp fragment (355)

Xem3.17 

AFLP marker, primer EAGGMCTG, 93 bp fragment (355)

Xem3.18

AFLP marker, primer EAGGMCTG, 169 bp fragment (355)

Xem3.19

AFLP marker, primer EAGTMCAA, 171 bp fragment (355)

Xem3.20

AFLP marker, primer EAGTMCCT, 179 bp fragment (355)

Xem3.21

AFLP marker, primer EAGTMCGC, 110 bp fragment (355)

Xem3.22

AFLP marker, primer EATGMCGG, 239 bp fragment (355)

Xem3.23

AFLP marker, primer EATTMCTT, 121 bp fragment (355)

Xem3.24

AFLP marker, primer EATTMCTT, 173 bp fragment (355)

Xem3.25

AFLP marker, primer EATTMCTT, 181 bp fragment (355)

Xem3.26

AFLP marker, primer EACCMCTG, 112 bp fragment (355)

Xem3.27

AFLP marker, primer EACGMCAC, 121 bp fragment (355)

Xem3.28

AFLP marker, primer EACGMCAC, 200 bp fragment (355)

Xem3.29

AFLP marker, primer EAGGMCAG, 182 bp fragment (355)

Xem3.30

AFLP marker, primer EAGGMCAG, 302 bp fragment (355)

Xem4.1

AFLP marker, primer EAACMCCC, 178 bp fragment (355)

Xem4.2

AFLP marker, primer EAACMCCC, 272 bp fragment (355)

Xem4.3

AFLP marker, primer EAACMCTG, 289 bp fragment (355)

Xem4.4

AFLP marker, primer EAAGMCCT, 156 bp fragment (355)

Xem4.5

AFLP marker, primer EAAGMCCT, 171 bp fragment (355)

Xem4.6

AFLP marker, primer EAATMCGA, 268 bp fragment (355)

Xem4.7

AFLP marker, primer EAATMCGT, 212 bp fragment (355)

Xem4.8

AFLP marker, primer EAATMCGT, 213 bp fragment (355)

Xem4.9

AFLP marker, primer EAATMCTG, 196 bp fragment (355)

Xem4.10

AFLP marker, primer EACAMCGG, 168 bp fragment (355)

Xem4.11

AFLP marker, primer EACAMCTG, 180 bp fragment (355)

Xem4.12

AFLP marker, primer EACCMCGC, 267 bp fragment (355)

Xem4.13

AFLP marker, primer EACCMCGG, 110 bp fragment (355)

Xem4.14

AFLP marker, primer EACCMCTT, 179 bp fragment (355)

Xem4.15

AFLP marker, primer EACGMCCG, 131 bp fragment (355)

Xem4.16

AFLP marker, primer EACGMCCG, 208 bp fragment (355)

Xem4.17

AFLP marker, primer EAGCMCAA, 186 bp fragment (355)

Xem4.18

AFLP marker, primer EAGCMCAA, 213 bp fragment (355)

Xem4.19

AFLP marker, primer EAGGMCCG, 132 bp fragment (355)

Xem4.20

AFLP marker, primer EAGGMCTG, 274 bp fragment (355)

Xem4.21

AFLP marker, primer EAGTMCAA, 97 bp fragment (355)

Xem4.22

AFLP marker, primer EAGTMCAA, 127 bp fragment (355)

Xem4.23

AFLP marker, primer EAGTMCAA, 165 bp fragment (355)

Xem4.24

AFLP marker, primer EAGTMCCT, 84 bp fragment (355)

Xem4.25

AFLP marker, primer EAGTMCCT, 130 bp fragment (355)

Xem4.26

AFLP marker, primer EAGTMCGT, 114 bp fragment (355)

Xem4.27

AFLP marker, primer EAGTMCTC, 196 bp fragment (355)

Xem4.28

AFLP marker, primer EATGMCGG, 138 bp fragment (355)

Xem4.29

AFLP marker, primer EATGMCGG, 270 bp fragment (355)

Xem4.30

AFLP marker, primer EACCMCTA, 122 bp fragment (355)

Xem4.31

AFLP marker, primer EACGMCAG, 205 bp fragment (355)

Xem5.1

AFLP marker, primer EAAAMCAA, 94 bp fragment (355)

Xem5.2

AFLP marker, primer EAAAMCAA, 107 bp fragment (355)

Xem5.3

AFLP marker, primer EAAAMCAA, 143 bp fragment (355)

Xem5.4

AFLP marker, primer EAAAMCAT, 134 bp fragment (355)

Xem5.5

AFLP marker, primer EAACMCCC, 184 bp fragment (355)

Xem5.6

AFLP marker, primer EAACMCTG, 149 bp fragment (355)

Xem5.7

AFLP marker, primer EAAGMCCT, 250 bp fragment (355)

Xem5.8

AFLP marker, primer EAATMCGA, 220 bp fragment (355)

Xem5.9

AFLP marker, primer EAATMCTG, 87 bp fragment (355)

Xem5.10

AFLP marker, primer EAATMCTG, 198 bp fragment (355)

Xem5.11

AFLP marker, primer EACCMCGC, 239 bp fragment (355)

Xem5.12

AFLP marker, primer EACCMCGG, 172 bp fragment (355)

Xem5.13

AFLP marker, primer EAGCMCGC, 205 bp fragment (355)

Xem5.14

AFLP marker, primer EAGGMCCG, 141 bp fragment (355)

Xem5.15

AFLP marker, primer EAGTMCAA, 179 bp fragment (355)

Xem5.16

AFLP marker, primer EAGTMCGG, 283 bp fragment (355)

Xem5.17

AFLP marker, primer EAGTMCGG, 285 bp fragment (355)

Xem5.18

AFLP marker, primer EACCMCTA, 136 bp fragment (355)

Xem5.19

AFLP marker, primer EACGMCAC, 119 bp fragment (355)

Xem6.1

AFLP marker, primer EAATMCGT, 121 bp fragment (355)

Xem6.2

AFLP marker, primer EAATMCTG, 102 bp fragment (355)

Xem6.3

AFLP marker, primer EACAMCTG, 112 bp fragment (355)

Xem6.4

AFLP marker, primer EACGMCCG, 203 bp fragment (355)

Xem6.5

AFLP marker, primer EACCMCTA, 103 bp fragment (355)

Xem6.6

AFLP marker, primer EACCMCTA, 191 bp fragment (355)

Xem6.7

AFLP marker, primer EACGMCAG, 100 bp fragment (355)

Xem6.8

AFLP marker, primer EACGMCAG, 108 bp fragment (355)

Xem6.9

AFLP marker, primer EAGGMCAG, 133 bp fragment (355)

Xem6.10

AFLP marker, primer EAGGMCAG, 238 bp fragment (355)

Xem6.11

AFLP marker, primer EAGGMCAG, 260 bp fragment (355)

Xem6.12

AFLP marker, primer EAGGMCAG, 315 bp fragment (355)

Xem7.1

 AFLP marker, primer EAAAMCGG, 175 bp fragment (355)

Xem7.2

AFLP marker, primer EAACMCCC, 224 bp fragment (355)

Xem7.3

AFLP marker, primer EAACMCTG, 195 bp fragment (355)

Xem7.4

AFLP marker, primer EAAGMCCG, 254 bp fragment (355)

Xem7.5

AFLP marker, primer EAAGMCCT, 130 bp fragment (355)

Xem7.6

AFLP marker, primer EAAGMCCT, 249 bp fragment (355)

Xem7.7

AFLP marker, primer EAATMCGT, 208 bp fragment (355)

Xem7.8

AFLP marker, primer EACCMCGC, 298 bp fragment (355)

Xem7.9

 AFLP marker, primer EAGCMCAA, 108 bp fragment (355)

Xem7.10

AFLP marker, primer EAGCMCAA, 222 bp fragment (355)

Xem7.11

AFLP marker, primer EAGGMCCG, 158 bp fragment (355)

Xem7.12

AFLP marker, primer EAGGMCTG, 164 bp fragment (355)

Xem7.13

AFLP marker, primer EAGTMCCT, 94 bp fragment (355)

Xem7.14

AFLP marker, primer EAGTMCCT, 95 bp fragment (355)

Xem7.15

AFLP marker, primer EAGTMCGG, 147 bp fragment (355)

Xem7.16

AFLP marker, primer EAGTMCGT, 81 bp fragment (355)

Xem7.17

AFLP marker, primer EAGTMCGT, 94 bp fragment (355)

Xem7.18

AFLP marker, primer EAGTMCTC, 151 bp fragment (355)

Xem7.19

AFLP marker, primer EAGTMCTC, 191 bp fragment (355)

Xem7.20

AFLP marker, primer EAGTMCTT, 171 bp fragment (355)

Xem7.21

AFLP marker, primer EACCMCTA, 131 bp fragment (355)

Xem7.22

AFLP marker, primer EAGGMCAG, 114 bp fragment (355)

Xem7.23

AFLP marker, primer EAGGMCAG, 202 bp fragment (355)

Xe33m48-115(3.8)

AFLP marker (296)

Xe33m48-119

AFLP marker (296)

Xe33m48-149(3.3)

AFLP marker (296)

Xe33m48-161(2.5)

AFLP marker (296)

Xe33m48-196(3.1)

AFLP marker (296)

Xe33m48-198(0.2)

AFLP marker (296)

Xe33m48-205(1.7)

AFLP marker (296)

Xe33m48-277

AFLP marker (296)

Xe33m48-280(1.6)

AFLP marker (296)

Xe33m48-310(0.3)

AFLP marker (296)

Xe33m59-123

AFLP marker (296)

Xe33m59-178(1.0)

AFLP marker (296)

Xe33m59-387(1.3)

AFLP marker (296)

Xe33m60-131

AFLP marker (296

Xe33m60-259

AFLP marker (296)

Xe33m61-90(1.6)

AFLP marker (296)

Xe33m61-109(1.2)

AFLP marker (296)

Xe33m61-217(2.0)

AFLP marker (296)

Xe36m59-83(3.8)

AFLP marker (296)

Xe36m59-120

AFLP marker (296)

Xe36m59-145(1.9)

AFLP marker (296)

Xe36m59-150

AFLP marker (296)

Xe36m59-201(2.2)

AFLP marker (296)

Xe36m59-285

AFLP marker (296)

Xe36m59-397

AFLP marker (296)

Xe36m61-146

AFLP marker (296)

Xe36m61-150

AFLP marker (296)

Xe36m61-190

AFLP marker (296)

Xe36m61-191(1.3)

AFLP marker (296)

Xe36m61-192(1.3)

AFLP marker (296)

Xe36m61-230

AFLP marker (296)

Xe36m61-263(0.1)

AFLP marker (296)

Xe36m61-290(0.6)

AFLP marker (296)

Xe36m61-325(1.2)

AFLP marker (296)

Xe36m61-346

AFLP marker (296)

Xe37m48-84

AFLP marker (296)

Xe37m48-149(3.39

AFLP marker (296)

Xe3748-153(0.5)

AFLP marker (296)

Xe37m48-213(0.2)

AFLP marker (296)

Xe37m59-156(1.3)

AFLP marker (296)

Xe37m49-157(0.5)

AFLP marker (296)

Xe37m49-189(2.3)

AFLP marker (296)

Xe37m49-281(1.3)

AFLP marker (296)

Xembp...

RFLP, cDNA clone pGC19, function: bZIP protein

Xfbp...

RFLP, PSR39 clone; wheat chloroplast fructose-1.6-biphosphatase

Xfed  ...

Ferredoxin (terminal receptor of  electrons from photo-system I)

Xger...

RFLP, Germin cDNA

Xglb3

RFLP, pLW2.1

Xglb33

RFLP, p7E

Xglb35 

GRFLP, 5

Xglo...

RFLP, PSP511

Xglu3

RFLP, DNA clone pTag544, function: low-molecular-weight glutenin, Copy number:1

Xgpi...

STS marker (331)

Xgwm6

(439)

Xgwm114

(439)

Xgwm126

(439)

Xgwm130

(439)

Xgwm131

(439)

Xgwm132

(439)

Xgwm156

(439)

Xgwm179

(439)

Xgwm205

(439)

Xgwm212

(439)

Xgwm247

(439)

Xgwm269

Microsatellite on 7RS; allele size 117 bp (410)

Xgwm299

(439)

Xgwm313

(439)

Xgwm320

(439)

Xgwm335

(439)

Xgwm340

(439)

Xgwm391

(439)

Xgwm526

(439)

Xgwm538

(439)

Xgwm565

(439)

Xgwm601

(439)

Xgwm676

(439)

Xgwm720